%PDF-1.4 % 421 0 obj <> endobj xref 421 146 0000000016 00000 n 0000004164 00000 n 0000004337 00000 n 0000004363 00000 n 0000004434 00000 n 0000004491 00000 n 0000004852 00000 n 0000005033 00000 n 0000005215 00000 n 0000005397 00000 n 0000005579 00000 n 0000005761 00000 n 0000005920 00000 n 0000006060 00000 n 0000006229 00000 n 0000006385 00000 n 0000006525 00000 n 0000006662 00000 n 0000006814 00000 n 0000006991 00000 n 0000007168 00000 n 0000007324 00000 n 0000007485 00000 n 0000007698 00000 n 0000007777 00000 n 0000007855 00000 n 0000007935 00000 n 0000008014 00000 n 0000008093 00000 n 0000008171 00000 n 0000008250 00000 n 0000008330 00000 n 0000008410 00000 n 0000008490 00000 n 0000008570 00000 n 0000008650 00000 n 0000008728 00000 n 0000008807 00000 n 0000008886 00000 n 0000008964 00000 n 0000009042 00000 n 0000009121 00000 n 0000009201 00000 n 0000009280 00000 n 0000009359 00000 n 0000009438 00000 n 0000009516 00000 n 0000009595 00000 n 0000009674 00000 n 0000009753 00000 n 0000009831 00000 n 0000009909 00000 n 0000009986 00000 n 0000010064 00000 n 0000010142 00000 n 0000010220 00000 n 0000010297 00000 n 0000010375 00000 n 0000010452 00000 n 0000010529 00000 n 0000010607 00000 n 0000010684 00000 n 0000010762 00000 n 0000010840 00000 n 0000011137 00000 n 0000011768 00000 n 0000012144 00000 n 0000012523 00000 n 0000012984 00000 n 0000013151 00000 n 0000013728 00000 n 0000013905 00000 n 0000014094 00000 n 0000014294 00000 n 0000014678 00000 n 0000015137 00000 n 0000015406 00000 n 0000015508 00000 n 0000015924 00000 n 0000016313 00000 n 0000016514 00000 n 0000016809 00000 n 0000019417 00000 n 0000021765 00000 n 0000021944 00000 n 0000022012 00000 n 0000024340 00000 n 0000026284 00000 n 0000028486 00000 n 0000030576 00000 n 0000032616 00000 n 0000034606 00000 n 0000037593 00000 n 0000039405 00000 n 0000043282 00000 n 0000046697 00000 n 0000047367 00000 n 0000047867 00000 n 0000047975 00000 n 0000050065 00000 n 0000050353 00000 n 0000050684 00000 n 0000050890 00000 n 0000051305 00000 n 0000051508 00000 n 0000051803 00000 n 0000052289 00000 n 0000052413 00000 n 0000063457 00000 n 0000063495 00000 n 0000063974 00000 n 0000064088 00000 n 0000110577 00000 n 0000110615 00000 n 0000111089 00000 n 0000111201 00000 n 0000165525 00000 n 0000165563 00000 n 0000165664 00000 n 0000165720 00000 n 0000166160 00000 n 0000166256 00000 n 0000166376 00000 n 0000166519 00000 n 0000166618 00000 n 0000166743 00000 n 0000166860 00000 n 0000166999 00000 n 0000167104 00000 n 0000167239 00000 n 0000167407 00000 n 0000167635 00000 n 0000167798 00000 n 0000167888 00000 n 0000168004 00000 n 0000168121 00000 n 0000168262 00000 n 0000168395 00000 n 0000168526 00000 n 0000168693 00000 n 0000168878 00000 n 0000169089 00000 n 0000169300 00000 n 0000169503 00000 n 0000169738 00000 n 0000003216 00000 n trailer <<67DCB0161DBF7B49AF5E3BE49ABE7987>]>> startxref 0 %%EOF 566 0 obj<>stream xڤSMlW&MQ@~p$ N`vJ 5vE`5k'mB(B@*rADVB Z[z}f̼}jقJ{1/ 0=ڏmmsE7tuUwڟY}lזUF}rO:9i__<I<=Qnec,ڤz#GӉT􅇉9v1" y9Nn CQiTM䱌i##O7߭ʱ 8/LD| OnmPVB'Ʉ;q"+_g8kL\x(*>NKg(iTswΎvYˮ:J}"?C\<(ǔx O)ۖ~dq*S%̀)'X2/1NqYJ!ʼOԹ +s J{X$I2h̲vJ:gn!(&fX{H3KC;Dn].<{*H|OZl$<'Kٗ8sH Hqb&{] 4Fu1JQ:aa߰ T"2XmuSU2nRMO*LT"MmM ej}|K;|l~",(߫P9ۄ)7`A`D?ɲ.4! GVqLc򽿹 AGF+Ph7ߝ!BY9|{^AM3pAU[ɿSp_E>E endstream endobj 422 0 obj<> endobj 423 0 obj[424 0 R] endobj 424 0 obj<>>> endobj 425 0 obj<> endobj 426 0 obj<> endobj 427 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 428 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 429 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 430 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 431 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 432 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 433 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 434 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 435 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 436 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 437 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 438 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 439 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 440 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 441 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 442 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 443 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 444 0 obj<> endobj 445 0 obj<> endobj 446 0 obj<> endobj 447 0 obj<> endobj 448 0 obj<> endobj 449 0 obj<> endobj 450 0 obj<> endobj 451 0 obj<> endobj 452 0 obj<> endobj 453 0 obj<> endobj 454 0 obj<> endobj 455 0 obj<> endobj 456 0 obj<> endobj 457 0 obj<> endobj 458 0 obj<> endobj 459 0 obj<> endobj 460 0 obj<> endobj 461 0 obj<> endobj 462 0 obj<> endobj 463 0 obj<> endobj 464 0 obj<> endobj 465 0 obj<> endobj 466 0 obj<> endobj 467 0 obj<> endobj 468 0 obj<> endobj 469 0 obj<> endobj 470 0 obj<> endobj 471 0 obj<> endobj 472 0 obj<> endobj 473 0 obj<> endobj 474 0 obj<> endobj 475 0 obj<> endobj 476 0 obj<> endobj 477 0 obj<> endobj 478 0 obj<> endobj 479 0 obj<> endobj 480 0 obj<> endobj 481 0 obj<> endobj 482 0 obj<> endobj 483 0 obj<> endobj 484 0 obj<>/Font<>/ProcSet[/PDF/Text]/Properties<>/ExtGState<>>> endobj 485 0 obj<> endobj 486 0 obj<> endobj 487 0 obj<> endobj 488 0 obj<> endobj 489 0 obj<> endobj 490 0 obj<> endobj 491 0 obj<> endobj 492 0 obj<> endobj 493 0 obj<> endobj 494 0 obj<> endobj 495 0 obj<> endobj 496 0 obj<> endobj 497 0 obj<> endobj 498 0 obj<> endobj 499 0 obj<>stream Hbd`ab`dduvpvL)1K5M1JM6NKIe!#g~ 102r/Zd` *23JV*ZZXIK0i`d``\Y\[_T_X_ZZTeZZRTX6bB }dQة`;ӹsTJ=f^'Y86Wf.3Chk`] endstream endobj 500 0 obj<> endobj 501 0 obj<>stream HT=o w~ǫ:ҡKЫN58)RcC] r`Xc)AZQ㋉fFV_탃%lhByЀD{%.6,բ寴^Q:nbʜuݫ"C,s j endstream endobj 502 0 obj<>stream HWrT|m0 $KubGfy5pP239=3 ʴmW 03=}?٪{jk> GbyD3mk[g(蟧?vΆ<2m;Vgfs0-x6QI5[E[벶U m6. WNT$tcjz `CnyXLwyoV^U3as. ~;o- MivO1VܴcYv{3vYV4{+ '͋ٮ;QG6Uޖ}c=9F,I\!MhWMa3!D)-#NX~ $191qIh(c]߹+'do朱LFNMleIS~ԿzW \u;4Y5HęznN^!.LCH'tؐRH#a>grc=[$ht;k*)8,a\:^{HL#'8I/B#reg ƞp}R-OgWYc?LB b!ɅzSUz9B%"9KI$JK||jnXp\(#ĜK0#i"O7v={լy@}"Hlfw,%ۼ+{'[uT~u::;wEiv~`maV`CJ)v૒R{¾%r((_VS g8ꐚaBEI /|['(RCRi5~=B1t_5--R*lrUVfMu+a_I(СmW謄N9yɔӀS_QFdF ox]ë?C)@?J-)5(E9f[P2:1]$#AD<5azl_ȗv0CcS&pgnvC0ʡz: -#0O"xh5J=@o6qwI+ٙ&Sɿy?J3=ymą7urn4tY?ڮ/Wc"5wP237ƛCc,8LGF[8 Vl#-zmÅ!lGJ8+M\;0Jk,f,e & Jr⃒L&( T*Y'H]xG#a(#&M͔4ǔCaq4@6b"T1v8Y㓅i:G3c/!Ee׷CXqR3ƪY;b"'ݮzܥ |sIΖyY#LpsTFp7svJ[HIA8 :8;K^Q0RXa}iؐm-U:0% 2[(gH6y]> m;%sg1ܨ7b4q K;>!T…YGiDIVۦk6^4j-Z&]>Oh סho?MxzpMC&J1DB5Go 'PqS4&*!ȮoDlpehjW HPy]Z '.Khb_o^&UZwT"X!}LOxv OmQRBf$Da}.Ƥz O ꢲtF]$௯M ~%F9C"OcKD INvsISuUIgps'<}L#+?=528Mu Ehe]lj}SCj"j^}P@׉;8RhŜ2!ȱ;<^i)/bzg 7i(בx,QQ?~ ]"/x8Wͩs Nި/ F)g~\7.E%'&w.fdk]+{;cX<ۨP }%^z]QTJ׿ Tz3*&u1Sz-80_.I:ҙ8W%WQYtd]OEE;t(U{oA̔QMsDd,=?M$!Y34b.g U!]A#׶ut'hrTG}HCMr? Ժg/ endstream endobj 503 0 obj<>stream HWێ}țT`q~Al!ȃLq<)r9736`N.mY}0+hmŪ72ej镉q7z#hDQtܵq9|g^?tr__s`c7FSQJ? @]N(qXi}mOitt GluGT\oC\ꯇiLKDe1I.aʪj¹kN[oi|O4k/ >EnSݰoxZs6>2KF8tMf Q)삠m6ct>>]CG'Z&Qp`V"=S! paol p,v.,gʜ3,A>.dKT5i[_Nk7kQλ܋e<ÿ7$5gCx2I5U$2bjjUohpĕqt'SBrJp܅@$dg*{LC}#Iw~sז. h-jv/.ݎ~>(c?Ż3Bw۝Nw*N 2?kQ.q7 Aw Y j;b% v]/S= k/ RrY[z6-?\XEy~TqK FE{_2^IҌ<ƋF ]@0ŊV3j&B<&'i4^ān yt,Bl$¶<p*t8[Ao!՗ZԪRqC#4m#:uYO9}~B+]mi.Dc>؏M#Gpl۷!{f<֯2.2~%)Z0hzw9#IQp|YaWiJ6qλO~[;^tnu7DrА y^Y%H2N|V +wØHTq/H EɦuPjWJUŅ{']9Xl,̛g shے=",eq6dTsUvVP*E0_'.ٜr@8<;ȖPVcT whr}Gr 6qLj$+g4 `[!i@:/g߄ٔpi}P<-ÆVR8hJ6%2IV4]jKsh (vo40L#9Yb IHJA,飖 XV8H8ۙV)cQ^2Û6Ԅ֘5H2eў13C 8"!~ARAM$9 {A<"$80/IQG9<^6I9(n"Ye/)1 y`v~|Bf<'H♳aF0Ѣ0YE̠S^{X.H"1%tѿN hL$g&+H¤--d"0! dKLB4!mVPښr5Dl7g H1s %3ǵCjdK3"iB;<9p^a #| cF 8hۡ:ROvpql(aR.f%i~AOZ q'(mɻL7HLwð0H\zї~'ngUoù\"8yzb%ddVw~@fJϕ̅MRvB[gEb쒚B\qδI Hu'Vm IP' e=xtP좃dPBtyUyǷOH?!+n"+ i|Li&2%K3\X} se䕪)cxn#e(Df!DR/#`$`^~q߄P nxG&#6~A}dD8k< 0bL endstream endobj 504 0 obj<> endobj 505 0 obj<> endobj 506 0 obj<>stream HW[SF+Q4{q†8qAhdP(6u.a&)Wѹ"*,aT.7D.0I)FH UvMJ$uoX¹HjقʔHAGEY#eLDiIa:R8RvhʔRyh%F 4g4cgpK *Ӕ{&7RRړ4U6=p$(q>'΄vS\ TzS"}m5uYty1#8JÔDiF5l& kiD#D25h2Oi-6F$? =!yH<51Y;ͪC%僇f䤾/bt[!$o+6pލiaWE/Cs",weXqjtCnaٽCXmI^;}[!(p?$NrfʟV?TOۚz-jPs "/*dMl+z[/3nJ_dmWUΓO%"le 5IxHfL. %ghzۿf@{)[3]vzY@" ;p`Hɫ=FqKQ5A )ώ͛m=,wʊ.UQ q^4fH낷{̺%c#2k)vlXIVT*$-׳݋>]qI169E״O7E5UU۬yF3Y~4QܶePEUed^I*k/~z^J~agۋmJ_F籬[i~a!H^0NH9P@CsM"Qz>O ~B/4>R殟;4/sߓ{M7 X*qZe(ߨ'Q}swjUΚ|.nq|yNc! )W4]%)5: 3%P ]h/ |zwjbh?_Vj{RF^F ?ȯ]:|p"uLvsk0FU`#oב̝11ߵ3fd4zR#9X ?08wk.8ό /Bd0U0o\D2# { rbԢ/%YQ~F:"; P4BR)M9uF2wgįW]`+,S0qFg`1@P|pAQ WsFD0s(Ø"!g P)G΍߸#ch 1AG0wxdo a(fGqH#9Z"QD d 9 >>ljhn5^ endstream endobj 507 0 obj<>stream HtWI$9+-DIS? э&rC1؈P6A2ţ?*bU$&.SJ$ -|hcmjru ~ J1H2N,7ve?Qeʘ{K^y؟Q'cKGLySq"ӉytUawR֍po; .Ae`< +3Df tŶ(%c.~] q-O G8SXy&n ˉqb9A+- .Di>0f9ib`r—-ҲUBP`eNVkn'S1{M3:JVeϏv}B?FgAKѕЅ W0Fԩ%eTYL];_lj@VR5rdB/z!k*X`˶2dRbV-y-󒿌[Q?׉jonR]㩙ͪf_YuaDpk}Mxh.*SPڿƋ]Z%UO~ ]ZDtn* i ) :+Np܈NδnUeeYHo|,- eA[70١䏾@=OVAg`r+uXOĀF6֗Ǿ P9Yx=@juVEPvjo&܈_Dϖ2M.aB,Fl@ӧ>m\(qAH$b\+dAYKZ;^Uvj;c&ڜ5rU8zR;Hڛx -=ᓮ 0 endstream endobj 508 0 obj<>stream H|Wˮ5W DH," !6L"8'=>g"[5vL&M~w."Szڬݚ-y}K߷XLvdZ)aE3pd`TT|)Lqj4 qKR?lo71Bd^ dI?IzpNӜe. ۄpj2>{YbjLJ@a. ќ,),<'<[ rjk\> 16dM6T8FNQ:Hp l>!F~Pc3CDBj??Wdh{'GOBE]'4)<LLJx2w ^!P!+ursӚNtcwI:-%k_/$PbV"HЃQH(P(."3Ο`zs /Wbd|ƅᲩKSԾqEoKn4]xJK7JK oujHBWM F9\l0IE.c3unE$U&? [`La{0_Qς aܘA?cs˅[J--w'LA&biܭhvg/>l™=2jU''9^vDu;d:?e7snL*?# (sX),+x9bf^i:n?^/βߦYDh8 !ZZ_`xQKbvֽã(Q)ʲ"Ҭ ^ x&FysHuf9> $2,8ZF 5908]'Ȃ;23s& tClv]+cn8QuR<`5V&Z̳W?&+hg֬e8f`kK]ksʽ XU4ΚAAΌP.Ed6jI c֔bF+mZ0oN4>yČĐ80N dnb3t c_=xDgNԁ/n?7 /mVqP,`<8ƺv^?_N89x1 aJ̼ X>Ao!7`a_tv{K|2t)>I1gјjC8NܶhfIc[SΝ fc>z>,.ßK ƄJT0 "A. L?E3E$[%B<˖v%2g96R -եv$f‚l((Sj !CcY8o/&UL8SfJĝI].376Px5k03rc͋TŔ16W&>-SfjOZ>qH, [E^M.2d>0,n΂Ҧ- hh3;i0(h录9u7=#M"-=FaxGת,UulU8 ?/vK&)2JL983J(%j| W݁wa}}HY*&88#ҭ`T.ϧ xuNYO<&;iOh endstream endobj 509 0 obj<>stream HlWIc)|C"AiY~r쪕4y0w {y{ ӲI6~ef- !?Յޔ잔ЭMQÛC#nXtSV\Wmޔ!s#4/mg"ͱ/8^07s8%QoC+kN da [`\ U8~РD܎j=Њ+\}XyܗE&˜ e)gHc_Q&ht'I%/J20 ʾ$c/N@5'}|x8 QEJ8 /3R$%E-o|LX5  Tvn6(2jF?@h7 Ϻ%6^~S~QQ AĂ!%&OV x]7M@I$D+^[7}mGgVwSl.pCJM.ڤuw ~''ĕmĭ'}{sx+z@"rҘIxS+b:iL;-7 zu%6 8)6⯔VCT4 |w@Q݈ gAZ5Xpv+7)0Vzj7-(Ig3dA E児ν sWiPoƲ+!TKyd~~ZSJo,*2O66ʢޛi4pĦW7^eXJ8vR)(E>*  L *M5VftH *9ʂSsqCQx2ptavwΡ|_zʩg"KL(wvêWdk`mw@)57讉 -ppV rb79 s"Kp|!jS-lXFkE{V/Wc (m @Oy94ag|uW ^u$V<#9ZI SE@Pl3˚f fݸ( rH}?(f%u[,ơ3_A)lH+s~gS8 7ߊNz$Hb#TاB()+g t{u]ǒW8(|œg N @:t tC;**31p#7ǝjhɨ7Gry{𝮶(RvaΎNpʫXyiu+F7K}{|$1胢 >dGl6X *hg['>5%P8%j׵uDB! :]Rv o*-=]nGfL̓gN bu|'H^1vcgųrd0Kv\O5s6Ukhg+C¹2 \= sD)4/?`,ld rG ȭI6 z8΋+9X*c ++1ޠΌQn.7ް.˱GD!Hx3!7)oHi|xwQ)zbdq}((m(=%޷Cm,~7MɔqVcgOʷwAx4;>/k|GF<()C.]ށaqO L2RwgS3:{\~S~.P#>!Tr%Ɔ Oc=(ï6ͪ⋯PPq]PԠk36@I̺Xr 7bS`^W g|'_?yj:怜eP82E4v/%!ga16)9W{OHEHR} D~f@  /Nu\ʵ"n]g%'x!19+59]^`91V endstream endobj 510 0 obj<>stream HlWK;)[}L^u$-$H%R/m^[%^$߿bkE⹟G;mK鱶e9(jSt>;,yx۞8qye6=֠t0MOLl p*ԉDD! {I5dEX /Ά 1r=ˡ` +&z1zrxg%@(b~^L|.x}h^xl{W[q<&3;qc&>]71Ȧ;P[W <*PP+n RJbCğ2;OY;l(_^SzY|BNP ,ĎЄ|L*[)uteYZm^qc1*3D:AOǹx#M}%k\w[eSGnv)[֡%;`uBٙq-3mr!wgarFOuHߗ°A&=HhAE DX&v f1]Awz룙&4ѫ#G֟_g)\YbQ5hKWsYTa6tQy9VXvZ3N9E>Ppz_E]ey?,h\>6x$UKZ\//h@ӿnaڇ!Б+ΙZLX{YV+W@e8h{`DQÆbVI|{PAYlSNMε1稚i' A'޼UVP)96 @.}(,LUx r~WCJƿ\$v ?>tT8YnXs&IN!GW\q0xOaBL7޺#nrH~7b|]C{bvx w,Bj0а'۔ȮRWDa!ԦVV86 Z)!EQ4{ sapE_jK^sM@%~94laXѿ 4mg~Y a`h5F$@R/F^YVp݆TOP!L޸9 %\3.Z><$=8+w[|gtr͉XEUT>7Ԁ;ZMz&0D:Ձ. kngd_nd)p"t^'bp,>e];09Q R}hl~T8Mmvjx3TM?-qY@Ϛ?iЅ3#9#ћ'?O; ]2z9ȃ= p) eѣn)`0HN&=vn+v9?`KG^F 2S5;ԇ0[Qǵ&̪#x1bVO~R}^+FG^mOa [JgotYtP>wi탧#@Ƽ8)>oy8>P B:XcSa`Lrv~oL]y8^/Ȇp06ht2 ύxj endstream endobj 511 0 obj<>stream HtW;nm7 ŏ:HU< H쿍_!-W;+ĕމ@ ?'(6f4Q~''pF@! &,oHHr56-~r/(kY}D&80fs@C,X5F*l?D6%H+874dvg2F!#9Qo@Ql|R<KB ?8N GcYC(aAB5#z|+b&yF4̻f6SnUW^LH3Xtᄈ>f^'`{ N .\ Ď!%Ho/<$#S"U-X |=Lɑ|ă}aŢ :` ÑA뱡ᆾ"75bG7Kg~}X?e?$|O~wFU*1 ڪZWbuAwX s'?:V' WoIm%GcIYwWپTvjh>؏ 6[}s\_.IzrGvr1}[aoKj4 /` 98)b s\<9I+G|,o\q̧Us- >hB#B 5ݰ !/ yt~[9zY 2Lelb=V ? wGi%gDF${qw[]s}#Ʋ?Xl=k m]-M@?w;-f81/4Pժ|Iy'K }8T,M,zYj本T}&*µsYNW#\_SwF#s(]Tߒ;;\g?Waa, v+re2ڵ}]x q[aܾ]_aQ% rӇeV^_&+zgشP@?$Xͷa/v|V ;@8b<5Ƚ$Lp q &]N.O{%DՅf%ozm`$a2'0]6"OV c 'qg WRwtΦ V$k FbBȭ|S_wbԔ<%I$wCK6q+3ڥ'5q@;VK_&#A}ep >=ց:G!\h88UHGK1*Ļ^ BDn棰! dFӵm[1z㉞FX|‰Ӕ)nL%~BBIh.6KD[bUxd V*ߪ2\e8 n.* XSnՠnys M58Lo:Чd Jݝe]$;>9p5qXcUsSr}r!1UE͑szպ$W`e3ÇzSdrKm*_l7 & x3xG [7ƖXn+e\q?~ 0T> endstream endobj 512 0 obj<>stream HdUiTW HV-vAW(zaI .EVP486FM0::E\@F1Ds4z oy̟wwR F(1Iɓ#V%XC`|%HBIǼ^gP_]=qR(Z]ezb&+αPZf]QO(-_l.}>ZjOC߱Y sV>ƶ2w"k>2>p??f(`3Hf `3Le(51&(3|aIXhwdu:-X ;(Ô=NVǖ6MnW-PUԢ:Q.R7\4...]c\K\wvv vKv[^=P̛qT&$-ZttJ"L`BQ0vN6Wb" ldB0Y[ 'AHS5=hO7j!*B>O?*EBDk`.,Y7zq,q*."h]UH{InP9#gomlVw6]|oTa@ ޮk0kz{-/Qo~=O×iazt}q&V֛¹ssC>@ɂ~`Q*pQl &綅Hc k ݧEf$F&->yeف ^l7p_- uYJ~0(jxXki  &>_(ؔ;gnYjXig{>܌]4$$K<-rx4b  wy̤M`9T3bN #< ׿-\:IBa8Q_ -^9x5ԡlG}cKL$|FKPJ <@nȔ IaTkAg"שvE/!rcA4v٥'O -A苦ߩ :xJ;)Lܩ~p2Ag=>xBc'$ KץZ"Z~tުya0Z#C#q rWPGKBQlЬ ˱/I1PGY|`=6,OX'>zwHIvюJܩv6%M `TR4Q(gR pqSޔ4ȧ`fia8Ҩ"I5& ,ՠD3ݱ`H\%"zڟ\ܙRL5Ջm9;#WL}u~m&q|E\uE3i^-b;.h/_r}evwNBu8r^^Z?]65,cV^XF.z2atsEtŌZCN+0 踝#ePUrQRKUX{& ۯ#e@.d NՏpGR9+O<i--5:l Nţ.7Q,ݎwX.S|f3:/Ωn=E.]Ζq m/ -̛-xh0֧gѓjNm-|Z5{7>/U0jtű<Z-<{Yib%T )y82%aaKzXo_߱` ~s*GN!^wdkv`*z}ᯗ%rp68$g'3G鴬"Fǻvq_aN*!-L1/?>zx0U&G W %\ȣY6$@Q ,'/z+WGJ, ;ooԊxr݇[7%`>( qy¿ZfC;'EC~٥w["'|pfH'ߺG2@_?6Eƹ +Q72B(@*a8jU(T>NsU- u:hOm ]liN6>1/)K2uSpG+C{z{k_k#sO$?t=8uw,7=xvmP68?թ#CsNښw<i|3r嚩sgOq% J\P0S/ "ktRde6ߖum-Ƥ2M | u: ] Ԕ#)7lNYC4Aﱓ_dP]{JyhQH;vF0q5˪Wˈk/ݤFBs]`Ŀ)8h q R&ZYb>) 9y #ҴԱ# p 15?F 2!-C!IAG@,, " 's2@rmۋJ eS^bg ̃:qz?0тFݎd ;鄑ҠSL{~+0W8Ep endstream endobj 513 0 obj<>stream HT{Pv{Ѫb6t?oC#(1KpyD`INXGK X@02hU >)41NMAlD&m=9w5{=s{J) H!j¨7!vE|5:aw%B8TرS* 9E挴|]Nv*x?[}W|}t9&]tQ^io.<;%ǜcޕoJy:)d.{Q3e$i&.\wW^JzF)[9? N㸅'rǹsRs Qq .㢔\48ΕՅSq^\>dBqO1TU>vXPp7TU O3uFS`|6N)M_ V03\Ox||hx?ڂf'a^~Dk~)N`h-Ȍ7yIWSDy!5D9.D,D^݅Ұ0?i6w&J|ZmLlZ HOOi'Jdg;[C<)cS%Xf'C>/{=)W3I+$הT[j*=\yS3dQku{'Ҁve*W Ȓ,f=$+o27>XpGU60.hЌl=Bb!J©dtkАMfj2P'>_uyp♁wwG5%.l|G++k^H%u]50NJNM^"Ee2$$ b$ -ޱ lH?G:?!B4190~TIB-A7oOC\+܇p^e+;hp^bv%E}F'Yn˼][5RXi97jc^+8%b7n \t{=,91)Y+l}bQRXч}DVj[4bŧή@O eӁ43 s.jYQ }nW:"^\#Cu­bG{J(H8DtHM5S1=w-kZXrAf#!V`v%v{d۲,ٯot|`FV@غ{0 7w:6%+>xLODzǣnSf%PK-}+PCؾX"("*/:K6 ʦX+oAK*5S=A:y֥He(B~ݹ| TYӁ4MB學i?DBG\Rf`K:UB7h. YfV,oZ4/ot endstream endobj 514 0 obj<>stream HtTiPTWn^{& 6 B(N8:&E\2e Q'D2&: (Pk v^5sgR̟WswwL򱙳BLUs"ͅcbb)?I+}P?/9@[wJ._ƲRרʾS"Fѡ(|YҼBܲRXi.Lee ]lrBE{{yIlRbfXV-[^XQTdyΔ>`y`Se.r8'Y,W%˔(Y=^a#Z'?*U)6(9srSYď$"r'O:{:'8sReT_xĸuZzMv w{"wI=]Y}Sqa095P2 00ӫt=^CŪl>54XY)A#H aJ*G ¾? :XZOՋM1[[)+s9L+ JZvRO|R4CF\_ U3`ZyAt9(.kU$JQNJ:zT\y03( VtCxq0X0 j:'x}2ׄ~>4,Ppn8iw0zȁ¦%/oHOGoF^CN<(.Ã3V?A:?t>>cĤ R~zqWOwvwtp偩єӾZqWOeРI:xA@4q$6:ea\¬[w/}{5u3E4,"!(:Zē5%|SPk@614eZMB-Es0 CH|M$ /*)A},at/( o=[f몢ZO>qFlm<% a 0'a102ڳV4.{<g,fz YLjSP&E-v{h&5_Ir7DfN(<,}zT7N桍eyS=sO{j-NFzլΕM )X#*x_ >i/kX oC3 xXLU> yO!u1Pf !R2ØoL|VS-*HL":iGpHޣzv)|4ܒ:nzr |*?1D-O#M>L2\#to=v-lS4V`æ 2Vs,eϧ/ݶ2Z " I7P&)4 ;=vB 8rAhU k|]~~-TQnFb,Mrƺс=lfcb wH1NPj/핼>Ŏa)kEO'-j_V%ѦaԐ. a;Ƴ_Foq6oǦ*VFїE5X.a)Ǚ$"/l=:ޅTƴD VfrVuDl, Hxz\L;,C О c &p}yE%F& z\lAX~AfC8#`D.^RVcPV!DC#AONK?p MΉX!jMo<.Ыm)#\gg›Le:iY3q61 DnKӽD ?*6IHէ$J#HyapdHZ\1>78,%}?{2hlWe<]n*A_,THc]Qhh,=]bɥUchVsܶ!5w+v!XPO] _$ڜE])G9"@37qmGRb E7,'fYh;X÷0Uطk]Vq[(1œ֚$gx{2-| C Gs+9}wW@[h f].7<)l47M{Bϋ6 9=\,:scI!,Eb꧰ n~!;#ꁋ d&6̑ɪyp~?QV!;P-foe'M}'E_lGH#6@+ ɼ8bT$ J:``pLCcl/`.6ݖ(q~YQMaA5w}_xm/ ~!ZzEsGH O)ᑤ'yb'/9>fK|k+帇2Os0 ,&<tFVߪ2Uv;$gbߟi67nǜSsTZ/JR$%k>stream H|U{XWM0DM`D(iBQu}BW Veqm*B~kۭb5ZR=qw'}?oνu3J&$ ;sz||bkq3S޴nѻ64F(U1!$Ӱ ^J*l{|%yQ#Buz}..8۪ZT(ضؖUj]%dkVZ05dk~0j[`le9EY%9ytq1l/,^YsPJNQ,OS*ԝ2J(MͥZ2IdRT;/pIdddNrH$i-nOe Y,+{_JbCN_7GF//DO~IA*)w{Q9e(ò&(& ah3ܾbLgk ΅u$(LQ=3U+Xp8+tgW |c g2"P3m"M2 D̀L< L-ײ0]=LL'!kB* #Hm >mUed0tH X˝'O?vk~ֻZ JX Y`A ,[vyj;R15۞j[r"bsh-&c CJS#-L,tM|Q2.JZ~0mf/aq(Pi@ ~> HM,VC  ҴsHfػZ@=|.20' @S{5" ܣ>_}/bLZ"0dX MsZwW(p&C `UG7=}=n(.:=<~ JTLi+o,K+aH_ح]~u[N5桊G}PWŬYv:8c`ƍmJXJ-]3[KA-l#En(A!~eNpH>Ԧ?p9nAـVHl^|raVҩrfϰB& {1a|j#wF5rmt]yx'HiM>,TlGbUJbNb$OA0%ltaJÓ9ɥi(q10¯d!d oFe(Éi xɣ d_54p &E=D"$ߟOE@ `!@V=1?܀Y5WM`jDq8Uůt&;ĿV&U {~/!kx^f=Rs% r1AAK.oV8J!BJCrq>!8DU3NJxN_ .^ kv:(g'A;EB_ |X)L7wbN&BX*\e غ!e^9AfhwmXc╗vpԷ_Q@)l^fO]i*Kaafjutgѭ-{Au`o?W7#BnEՖbE)[ꆕ_Ya?z;5O7B@~jLyiZ 2|/,g oi`'ڮES=}] J> ApDt.BD.}i͂qH'0U~лٽz\MC\ zp0j$䖂ܝfAs0H5z-QIZ}=O\[mg}P(=5 >Jb`ưt*K݃e2lJ%>Ԥ)3L|)kd I֮O{UX*=R'}H?o8zN Woٳ\w4_[eV}]yHT*vEAbdկEr1࠼j5V>t?# }av$Hכɻ4 n%HG_Xa9S2<@Xia# V.Ts6-? F_:M^/ޱRުXsh‚ ̳0kВT#sy5+vk8}oc<6©h,clz^RJJ*Kg40N&\D6qj i;~'3Vwo)1Rdʵr ُuJdD%Ar"pdŔjb8ǛiRz>p, yxKAx^%DY endstream endobj 516 0 obj<>stream Hbd`ab`dduvqtvL)1N0IM35IHf!#_հ~w.#cLs~AeQfzFF4 L+8'*W+x%%)8()V(J-N-* :<.f`bXGjQnlmj7W.٘:fr⤀2稂F,=\^lޞi;g=Yœfg,.[ye n{L+,'pi㔊y˛wg~QwwQU%MU=uK/n\ݶpI&m9ViYBl'Er!I7/@ݬX}C)ݧMHַse[m͞V7rAعsf⨈JvJSnE3w-}|?.!=1Xγae2e+Wmo<\5"ƙkRwI_7}"]kg.2cRvWѺ™ [w/ݿ|k9Zr gsj^Tꇈs p endstream endobj 517 0 obj<>stream H\@@$9OWs,]՚Vӡ+L4B0URQ5 !rĺ eۆM[һr[vi JGLGc2'ʹhM\&^oMoqF)e3,ٜDN}xcѓWGO^P\Y5 w0}u8Q+\)+Ɇ:)9nrvܲp=ٓ|`pW=^B~;R|?\<h.N8_%| 0RSD endstream endobj 518 0 obj<> endobj 519 0 obj<>stream HUkXT>} -.=gR% E]*((E˂( W.rU HwZ"" #iy4 ?z?nM&dlЫsU! C\>UҦtFlN7N@=XO۠7$ *Mq)t6u ?.0eI 3لq0 0jdY0&X,5e&V"1)ʄ2iU +KJL&dJRi1 3m &$đzNҕ0}))*VLzfDV4u&Fx틱Of&r|)ݵ&79vOQi03C/"b{g$0¬"]ɗ ߲{;ft?3LsC9zJ`X́{]̋_RcRg{桙odgl;s:B'в] z;pQpϹzRY!l{ 88#o{뾱)oϦ嶂Bupb0֢&B6Zw- H%wN,ҷyZ1湳I/G"0ASɂ3~.X0r%_њ,CZ40mO,^k 3$ FcMaOk ~E{Q/Bڼe'û-խ5ĤԒ$EL `/:N炃@3'k_'8%ii}F {؁; B Xuo>yS)tX BA0XCߵ>hP|ásLT+¼t9{YvW#[| %Z)>)*kF #96r)MuhIqmlR-8S ` t[(Z4Z3(7D~pZR)VZ6oYa2?^فô2 5Bd8B>d<٤wDe=3>GW&lP'$K͐q\SnOWC_іuko?pCsRpv.oom]]F} e*۫+J휷%E)&//auh1f]0 Ra&H@b4i(- 1$OvEM8?\qXZPtJ& f`.uBO@w^0,_w%G/7_p[sβ<[x(ԱJo?Έlr} mMͶE$yY˜%'zJx1eT:qx|o˫hiw@]8[{Ֆimm:b]~aq~q>h9孍]KBc41|G(4~MbPyA.a\~ayn~)nl,==y _wكA"4/-F{r|Z{RsӴ?qғv&hpnG:_q=G2Þc'*'2kv@DBQ'8q|iű'D$#?$EAYZQ?H v&=3@4Gg>` ؑ :暤w22XyљA^`({+\3x/༫~xl$7GHq^YVwu_QSH*kcq[ Qh@&T@!(7:X4k5dcaVQ WXPUU!K9<.nFcB{FxKn endstream endobj 520 0 obj<> endobj 521 0 obj<>stream Hbd`ab`dduvpvL)1LIML21162Jf!#ꯚI[wv_/8}s~AeQfzFJCK  ii&u SR+KRs< KRSsr@RS@` =R3SRsRS\Js32R&AL(3@r2Eߙ~drk+H+nekHhH0lY^ endstream endobj 522 0 obj<> endobj 523 0 obj<>stream Hbd`ab`dduvqvvL)1LIML211NKJe!#6Dž'.VҼL7'#e_PYQRBHZIc##ǔTbϼĒ=ǜ bԢ2((Cv̔ԜԢ"̼<Gw= E`&`o ̌L ~x~c*۬ˬ_xLzƌN,+)6Mv`5bc}ʦ'ɬ$b3Շ dTc Pj Kw=b endstream endobj 524 0 obj<> endobj 525 0 obj<>stream HT=o w~ǫ:ҩRЫN58)RcC] r`Xc)AZQ㋉fFV_탃%lhByЀD{%.6,բ寴^Q:nbʜuݫ"C,s  j endstream endobj 526 0 obj<>stream Hώ0<%M+5YUD)]ސLVSqx-j7|sBրd;e OJTU/;VjUwy׸P&]AEe7Gݧ9%C ]/?V ɔeIlh&){Cgs_m뫷GZ zr۶eYie|2i+poPt Om&jS6AWW5'{0/L|Y#ο;&LJ!* ۸."A}@ߧ_\$ME%&a䠡!I/V2rQhU. Yym(:;jTal_h> endobj 528 0 obj<>stream application/postscript Adobe Illustrator CS3 2018-09-24T14:18:04+08:00 2018-09-24T14:18:04+08:00 2018-09-24T14:18:04+08:00 256 28 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAHAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A6n5287+YdW8xHyh5SJSZ WMd3eIaNyX7YV/8Adap+03Wu3zKtQ/kNBNCZNS1maW/cVeREBXl3+2SzfOoxtUskvfOn5ZapAl7c Pqvl2duK1JIoOoXkWMUgG/GvE/qUPTNb0jT/ADf5diiS6kis7r07iK4gIDFacl6g+O+BLxvyd5IX zB5i1jS5NSuIItNZxHIp5MwWUxjlUgdBkkJ35m/L3XvJ+nPr2ha5cP8AVCrTxGqtwJA5bMVcAndW XpgtWYWUcP5i+RLF7ueS0lZw1w1uQG9WHkjdQdmrypil5p5F8kL5l1XVrObUri3TTmAjZDyLAuy7 1P8Ak4UJn5v/ACl1fS7e3fQ7i81WWRys0ew4KBUHY9zgtXoH5k+U7fXNKN5LdT276VBczRLCQA5K BqPUH/feIS8q/K7zxcaDq6w6hIx0fUX9KWRySscq0pICfDkA/sa9sSh7R5t8rWvmfTIrGe5lto45 lnWW3IDEqjLTcHb48CXkf5V+U4te1S+nub25jOjz27wqjCj1eQ0fkD/vodMJQ94wJdirxn83r7Ud Z81Wvl3SyzSWNvJPKiEishjMrA08I4xT3OEIZh+UOvnVvJ0EUr8rnTmNrKSakqu8Z/4AhfoxKWUa 5rFno2k3Op3hpb2qF2A6seiqPdmIAwK8k02x86/mZNLe3l82meX1cpHDHXg1OqqgK8yO7Mfl4YUJ pcfkTbwRerpGs3FvfIKo8gHEkbgVj4Mu/ffG0o/8mvNGtavZ6lY6rObmTTXiEVw55SES8wVZurUM exO++JVL/OPnPzHrvmVvKPlFzE0ZZLy9Q8W5J/eUkG6InQkbk7D3VXRfkNZSxc9Q1i4nvXFXlRVC 8v8AZ82b78bVLdOTzP5H8/aZoJ1R7/S9RaMCOTlx4SOUrwYtwdWX9k7/AIYoTz85fLEM2k3HmYXc 8dzYwwwR26MBEwa4pVtq1/fHviEsf8l/lZD5g8tWerzavcwSXPqcokoVHpyvHsSf8jG0Jj5W8i63 5f8AzIh4fWbrRoY3/wBOk2Qs8J2IB7MaYqs/MjVtb1nzrZ+TNPu2sraQILhlJHNpF5ktShKqnRa7 nEKpaz+SY0vSZ9R0jVLhtQs4mmVOFDIUHIqnpnkrEDbrvjasw8i61rQ8htf64krXlks7P6ylJXSE Fl5cgCTTauKXnnlXyzqn5k3F7q2uapKlvDKESGPejEcuKKx4oqqfDfFCIu/KvmXyJ5m0xtBurq9s Lpx68axuUCh1DrMF5IahtjtiqK/IWOO4v9dv5jzvaQryP2qStIzn/ZMgxKvYsCWIfm1bW0/kLUmn ArB6UsLH9mQSqop8wxX6cIVR/J2eaXyFZCXcRPNHGSa1QSEj7iSMSrzzyj5y0jyv5y8xXGpLK0dx NLHH6KhjUTsd6suKE187fmvY+YNHk0LQLO5mudQKxuzoK8eQPGNELlmalMaVn/5eeXp9A8p2Vhci l2Q01yvXi8h5cf8AYigwFLyPyXr/AJk0jXtdbRNJbVXmlInVQ54BZH4n4PGpySHpnlDzZ5z1XVja 6xoD6ZaCJnFyyyAcwRRfiFN6nAlkXmf/AJRvVv8AmDuP+TTYFeOeQ/J0Pmj8v9UtRRb+C8MtjMe0 npJVSf5XGx+/thQy38ovOE91byeWNWrHqumApEJNmeKM8Shr+1Edvl8jiUpZ+Q/+9fmX/jJbf8Sn xKvW8Cqd1cw2ttLcztwhgRpJXPQKg5MfuGKvFfy38yaCfNGteZtevorS5uWK2schNQJW5NSgOyqq qMKFb8ttX03SvzH1PSbC4SbSNTLfU3Q/DyWssQ38EZk+eJVkf57TSJ5Nt1RiFlvokkHioilan/BK DiEsq8j29vB5O0WOAD0zZwPttVpEDufpZicCp3iqkYkgikaCJQ/EkKoA5EA0BpiryT8g0jmuddvZ TzvD6Clz9rjIZGY1/wAplH3YSr2DAqxoYWcOyKzr9liASPkcVYl+bv8A5LzVv+jf/qJixCsD8kec fPWneWLKz0vy29/Yxer6N2FlIflK7NuopsxIwoen+TdZ13VtMluda006XdJO0aW7BgWjCKQ/x77l iPowJY3+Y35c32t30GuaJcC31i2VRxLFA/pnkjK4+y499unTCFSK2/NLzn5bmSz846S8iV4i7RRG 7eJBFYZP9jTGkPTtL1TStf0hLuzcXFjdoymoI2NVdGHUEdDgS8sl8k+fvJOoz3vlOT6/pspq9qaM 5UbgSRHjyIrQNHv8sKE+8p/nDZ6jfJpWuWjaZqTuIlbf0mkO3Fg3xxknoDX540li959e/LTz7LqA geXy/qRb7A29N25lBWi+pE3QHqPnih6bafmD5KurUXKazaohFSk0qxSDatPTcq/4YEvOPzB86N5x ubfyr5XR7qKSUNPOAVWRl+yBXpGh+Jmb9Q3KHpuj2ml+VPLVlY3N1Fb21ogje4mdYkaRyWc1YgfE 5JAwJeWflvfeXV85+YpdTuLMW80khtXuXi4OWnJHplzQ1HhhKHs1vYWNsxa3tooWOxMaKhP3AYEt X2o6fp8Pr391DaQFgolnkWJOR6Dk5Artirx/8o9a0aw1/wAxS31/b2sU7qYXnlSNX/eSH4SxAbY9 sJQzXzf+Zui6NpS3emXVnqtyZVjNrFcxlgrAkv8AAXO1PDGkph5k13TY/KU8l7dQWk2oWErW8Msq IXZoalYwxBYguBtgVhP5FappkGkXllPeQRXk93WC2eRFlf8AdqPgQnk3TsMJVU/NfyzeadfQedtD Hp3do6m+CDw2WUgdR+y/t9OIVDfkDIZJfMUhFC7WrEfMznEq9ewK88/OLzZZWXlq50m2uo21K7dI JrdHUyxxMPUYugPJQygDfrywhVvkLyH5Ju/KtjLNb2up3hSt5OjiTjK/7wxMUagZFcCmKsW/NLSd D8satpGpeX/q9reWsgaeyjceoCpEkUjR1LcTRgTSnTEIZ/5ht9K8+eTZ7fTLqKaZkjng4urGKYDm qScSeBIJU16YpYj+W/5i22jW3+GPM3KxnsnMdvPKpAVSa+nL3UqTselPCm6UPQLzz55NtLczy6za MlOQWKVJXI9kjLMfuwJY1+V/nLXPMuoay94/PToGX6l+7VOIdnIUso3PEDCVYpOb78s/Pk14YGl8 v6mWpw6emzcuIJ29SI9j1HzxQ9PsvPvk28thcRazaKlKlZpUicV/mSQqw+7AlhXmD8z7q584aTpX la8FxaSyxxXpSJXVi8gBCMwrsnUjbDSp1+cGp6bH5K1LT5LuFL+ZYHitGkUTOouU+JYyeRHwncDs cQqG/K7zN5bsvImmW15qtnbXMfr+pBNcRRuvK4kYVVmBFQa4lUY/5lWsnnex8vaesF9aXagtfwTi QK3F2K0QMtRwHfvjSpTc/mLfaP8AmVdaTrdwINC4gW5Ma0UvGrIxdRyK1qPbv0xVM/PnnLyRL5Vv 7eW/tdQe4hdLe2gkSZzKV/dtRCeHFqHkemKpD+Wi63pv5W6vf2wZZ2a4udOUryr6cSryCmtash29 sVTb8vvzO0zUtGC69qkEGrRu4l9cpbqyE1QqTxQ7beONKw782tU0XzBr+lWvl5kvNUBaKW5t9wxd lESB1+1xNTUdMQh7Hrv6E/Rc36b9D9G0/ffWePp+32u/h38MCXk1x/yoH124+rSu/p/XOH0ct8KG feRP+Vf/AFaT/CfodP3/AB5fWKf5fq/vaV8dsCUZ52/wr+g2/wAUf8cr1E5f3395+x/cfHirAIf+ hffWT0/7zkOH/HS+1XbrhV67gVj3nn/CP6FX/FX/ABzPWTj/AH397RuP9x8fSvtirAP+sef8/wBJ YVd/1jz/AJ/pLFWVedf+VZ/U9I/xP/vN6b/or/er+74x8v7jfpw+3/XFUn8uf8qS/Tll+hf+Or6g +p/73/3nb+8+D/gsVekXv1T6nP8AXOP1T03+sep9j0+J58q9uPXArFfy+/5V5XUP8H/8VfXv96f8 v0v96P8AZ/Z+ntirMMVeb+bv+VN/4hu/8Rf8dn939a/3u/30vD+5/d/3fHp+vCrJPIX+Df0PN/hL /jnfWG9X+/8A7/gnL/ej4/scem2BUh86/wDKo/06/wDif/jq+mnP/e37FPg/uPg6YVTjyB/gT6pd /wCEP95/UX61/vR9vj8P+9G/TwwKhfPv/Ks+Sf4q9D61T93x5/WePb+4/ecfDlthVhdt/wAqB9Ve Xq07er9c4/TxxQ9V8uf4e/RUX+H/AEP0bU8Pq3Hhy71p+1413wJVNd/Qf6Mm/Tnofo6n7361x9P2 +138Kb+GKvJbj/lQXrNx9alf91/XOH0ct8KGZ+RP+VX+q3+Fvq/1yhrz9T6zx78fX/ecfHjtilR8 +/8AKq/0xD/i3/jo/V19L/ez+45vx/3n+D7fLrvirG/+sef8/wBJYqmvlb/lS36fs/0D/wAdfkfq n+9/2uJr/e/B9mvXFU98/f8AKu/Sh/xZ6PqU/wBH/vPrHGv7Po/vONfoxVhGnf8AKhPrcf2+VRx+ sfWvTr/lfs0/1tsUPYLX6r9Wi+qcPqvBfQ9Knp8KfDw47cadKYEvLPMn/Kjf0lL9b4/XOR9b6l6/ Dl3/ALr91WvWmFCc+Qf+VU/Xj/hr0/0nxNPX9X1+Pf0/X9uvDFL/AP/Z uuid:A7354AFB96C1E81186C0E1ACBCA73DB7 uuid:A8354AFB96C1E81186C0E1ACBCA73DB7 uuid:fe3e98a7-5223-e141-97d2-3629640fb861 uuid:46322547-5fae-1945-9ee0-dc108487ccca 595.276001 779.528015 Points 1 False False Black Default Swatch Group 0 endstream endobj 529 0 obj<> endobj 530 0 obj<>stream Hn0<%؛@$ڤZXJ y٭Ù(Z<.q3oY^alA=DUv9[sSvnv_n宖YEOE@Azm[C)K.jsVH,K7d΅-_,Bɯ/>i1*9ﺎu'̅-O,9ϓX4E%ձ6l4Ĥ3\xf0G,bv-@97r/䘘]Vг\j6WׯIG zJr`bÊd7cZ4> endobj 532 0 obj<>stream application/postscript LOGO_journals 2014-12-02T11:35:18+01:00 2014-12-02T11:35:18+01:00 2014-12-02T11:35:18+01:00 Adobe Illustrator CC 2014 (Macintosh) 256 76 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgATAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A775889WHluOC1luI7a8v lc28szKiBUoGNW2qOQpXDGUb9RTLS6rJjJwQM651vXw5vPINepFJf2+ofut3kuopaivUsXU5l8cC OY2eXzYNRgl64zhLzBH3pr+WX5l3Os+Y7+yvrzjpsFqZbd7gqpLLIqlizeIfYVzXSzxMu6Ls+y8m TLIw3kaegXPnPyxbV56hGxHaKsv/ABANlUtZiH8T0UOzNRLlA/Hb70dpOr2Oq2gu7J+cPIoaihBX sQctxZo5BcWjUaeeGXDPmjMtaHYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FX Yq7FXYq7FXYq7FXh3/OUtkH0jQb6m8NxPBX/AIzIrf8AMnKcvMPZ+x2SsmSPeAfl/a8A0yX072Nq VLckAG+7qU/42ymY2ej9o8Pidn5o/wC1k/6X1foZf5V1C3t9ehgkcCS5R40HvTkK/PjQZj6nTyli MgNovkfslGQ1XF/DwkPQM0r6azX8stY9DUZdNkakd2OcQP8Av1Bv/wAEv6s2fZuapGJ6ui7c03FA ZBzj9z0zN28q7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXY qxbzD5j8lT27Wuoxw6tGDX6sYkuErSlfjHp/jmBm1+GPXi9y49WcRuEjE+Rp5frXl7yFqd0n1Hy7 Dp0nMcLiKSVGG/URoyxfepzV5u0jR4Y07CHtDq5DwzPihP0m6Ox2Pm8E1CDUtK1+WGRiL+yuKB6f txt8LAeBoCM7bTSx5sETEeicfvWMBp9htwPVz5pt/SjKwOZSAZEJCgHuAw5V+7NVD2VmT6pgD3X+ p12f/gjYR/d4pS95Ef8Aik78h32paz5vsLazjEEaOJ55CSzJHF8TEEcRv9kbd8yJ+z+HBDjMpGQ5 chv9v3uDh9tNVrcvhRxwjCXPnI177A+zm9q83+YB5f8ALt5q3piV7dQIoiaBndgig+1WqfbKXPeb +S/PH5keYtagdUR9IjnjW/MUSKiIx3AZqv08CThQ9gwJdirsVdirsVdirzSH82dQk87ny6bCIQi/ ey9fm3Lispj5U6V2xVE/mFrH5jWWtQxeWbaSawa2VpWS3WYesZHDDkQf2Qu2Ks50t7qTTLSS7BW7 eGNrhSOJEhQFxTt8WKonFXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq8HzinXKtr/vTD/rr+ vBPkW3B9cfeGLeePId3qPmi11exg9UPGfrSggfvIqCNiWI6qf+FzdeyvbeHDiOPPLhEDcfj0289/ i7r2l0ufJhMcEeKc/SeWw68/LZNdG/J3zbqlutwDbW0LGlZpCTsaHaNXzt8Pbmnyw48ZMo+6vvp8 5Psvq4mp8MT5n9VvUvy6/LlfKZurie4S7vboKgkRCoSNTUqKkk8jQn5DMLWazxqAFAO/7K7JGlsk 8UpfYEk/O3QLufTv02t6UtrRI4ZLGjUkZ5dmJ5U25eGYLuWH/lt5X1DULW71e31FrWHTn5S2qhqS 0jLdQyj8MKEl8szec9W1B9M0i8uGnu4zHKTMwCxBlZiWJ+EfCK0+XfFU+1i980eRNFby2bpEvtQk a7lureRmZYCAihGYKVLujVPt74qoT/lv5mtPLC+axej1/TW6eFWcTLEwBD+p/MAakdvHFVa68+6t q35ezWt1cv8ApKwu4ALpWKvJDIslORWlSpWhPfbviqh5Z8r+dfOWizLDqNNNtJWCxXEr8ZJioYjY NWg47t0rt3xVD/l/PrV3qM/lWG+ktYdUjkj6llikhHrc1AK0NIyux74qlcOhXT+dToYvCt0L97T6 9Q15rKU9Sla7kV64qnn5i22seXL3StJOpzTvDYcpJ1d05l7q4epHI9AQvXtiqYee/PervDpvl3T7 preJLO1+vTh+DSSyxI3FpNqKFYV38a4qlGteWofLtlBq2k+abW81BWX6xFZzqJVZt+UZSRmdQeuw 8cVTPzR511HWvIWk3bTvFfwXclteSRMY+ZWMMrfDTqrCvvXFUHoXlb8wPN2kxTQ3Z/R9oWjtjczO oZuRduIAYkhm+0flXbFVDzvrWqX/AJvn0zWL2W0022nFt6a8nSOFDx9QRAjmWX4/E4qmGkeXdRst ahk8l+ZLW8B4ukbzC3dzXeN7djVxtvir3pCxRSw4sQOQ60OBLeKuxV2KuxV2KuxV2KuxV2KuxV81 ar538r6ZVbm/jaUf7phPqvXwIStPppnOafsnU5eUSB3nb7/0OqlmiOrD9R/OkRyA6Rp9WUgrLdHa o8Y4z/xvm7wezAI/ez+Ef1n9TUNWQQQOTPPJP5naL5lVbaQix1am9pIw4yHuYWNOX+r1/XnIdsez ebSXOPrxd/Uf1h+nl7uT23Z3bOPUek+nJ3d/u/FvcfKX/HDh/wBZ/wDiRzfdgf4rH3n73C7S/vj8 E4zcuAwv84f+UCvv+MkH/J5cVYt+TX/KI+Yfm3/Jk4UJN+RH/KX3f/bPk/5PQ4Epr+e3l+8e5ste iQyWyQi1uSor6ZDs6FvZvUIriqE1H83LC68hnRhbS/paW2W0lchfRoFCNIGry+Jeg49cKGLReX7y 2/L+71m4Qxx3l3bxWoYU5IiyFn+RJAHyOKvTvyI/5RG8/wC2hJ/yZhwJef8A5Y/+TOsf+Ml3/wAm JcKENqt5+g/zQu766jZktdUkuXjX7RjaUyCladVbFUR+auvWev6tperWaSR21zp44JMFDj07q4jN QpcdU8cUqHnzQ7jT7/TdTliMun6haWkiNuFLJAiSRFh0Pw1+RxQmOo6l+T8NjFNYaPdXd29Odq88 sIQd+UlZAf8AYg4qp+a7Oxj8iaXeWelPpEV9eSSJbyTvcF0EQVZKuqFeXYU6b98Vep/lJ/5L3Sv+ jj/qJkwJYH5080aPJ5sm0/zR5diMcEvptfRPIlwYK/u5BxKcvhoaE4UMK8yw+XF1mJfKctzPbsFK +qCHExY0WPZWPam1a4q+ldHF6NIsRfmt8LeIXR8ZeA5/8NXAlF4q7FXYq7FXYq7FXYq7FXYq7FXi v5pf844aPr3rar5W9PS9YNXks6cbSdu9AP7pz4qOJ7j9rM7BrTHaW4cHPohLeOxeA2v5RfmXdarL pcPl28+tQuY5WeP04VYb/wB+5WGhG4PPftmxOogBdh1w0+QmqL0ryv8A84peY5zHP5g1aHTV2Y29 qDcTCh6FzwjU+4LZi5NfHoLcrHoJcyafRflrQk0LRbbSku7i+W2BH1q7ZXmepJ+NlVAevh881Ecc I7QAiO4cnbcUj9RMj3nmmeSQo3ljZX1u1te28d1btQtDMiyISDUVVgRscVUrLR9IsYZIbKxt7WGb +9ihiSNX2p8SqADt44qssNA0LTpjNp+nWtnMylGlghjiYqSCVLIoNKgbYqjJI45Y2jkUPG4IdGAI IPUEHFUjXyF5MWf1xo1pzBqP3S8a/wCp9n8MVTW80zTr63Fte2sN1bqQVhmjWRAVFAQrAjbFXWGm 6dp0Jh0+1hs4WYu0UEaxKWIALFUAFaAb4qh7Xy55etLpbu10u0t7pSStxFBEkgLAhqOqhtwSDirt S8uaBqcgl1DTra6lUUEksSO9PDkRWmKqbeUvKzRxRvo9k6QL6cKvbxNwXkX4rVTQcmJ+ZOKo2fTt PuLP6lPbRS2fEILZ0Vo+KigHAilB2xVKrbyJ5OtpxPDo9qsqmqsYw1D4gNUYqmd/pOl6iiR6hZwX kcZrGlxGkoU9KgODTFVS0s7Oyt0trOCO2to68IYUWNFqSxoqgAVJriqG1XQNE1ZVXU7GG74fYaVA zLX+Vuo+jFUPpvlHyxpk4nsNMt4Jx9mZYxzHyY1I+jFU3xV2KuxV2KuxV2KuxV2KuxV2KuxV2Kux V2KuxV2KoPVtWstKszd3jMsAYKSiM5q3TZQTiqSeXbzyzpHlP65p8sz6Qjs3qOrNJyaQIfhChvte 2KqzefvKwsI70XZeOZ2jiiVHMrOvUCOnLavXpiqK0PzXo2tTTQWcjC5gFZbeVGjkC9K0btiqb4q8 7n8o+XD+YUenmyX6nJppuXh5PQymZl5V5V6YoZU3nDy+mrNpUtwYrxOVRIjqnwLzb94Rx2UV64pQ sX5heWJLqOATyKsz+nDcvE6ws3TZyPHviq/UvPfl3T7mW3llklkt9rgwRvIsZ8HYDiDiqYS+YNKT RhrIm9TTyqsJY1ZyQzBB8IHL7RodtsVS8effK5sEvUujIkkjQxxJG5laRQCVEdOWwYGvTFVS087+ W7mzurv616MdkQLpZlaN0LVC/CRU1ptTFVumeefL+oX0djFJJFczDlAs8bxCQf5BYUOKq1n5v0O7 1Y6TDK5vgXX02jdRWOvKjEAdsVXa55q0bRHjTUZHjMillKxu4oDTcqDTFXa15q0XRlhbUJXjW4Ut Gyxu4oKdeINPtd8VQ1/588t2cohM73EvASslvG8vFGHIFiBQbHFUz0jWdO1eyW90+UTQMStaEEMO qsDuDiqV3vn3y5a3Ulqssl1ND/fC2jaYIR2ZlFMVREF35b816W6Iy3tmWAmiPJGVlPIBl+FhuMVS r8s444dDvI0AWOO/uFUdgq8QOuKhEz/mH5ZimkjjlluVh2lmt4nkjX/ZgU+7FU60vVtO1W0W70+d bi3bbmtdj4MDQg+xxVJ7vz/5ctrqa2Ektw9uaTtbxPKiEdQWUU2xVcnn/wAqy3EVvBdmeSVQy+nH IwAb+Yhdj4g4qu0vzz5d1S/Sws5pHuXrRWikUDipY1LKANlPXFWtS89eXNOv3sLqaRbmM0ZFhkbs G2KqQdj2xVkGKuxV2KuxV2KuxVif5W/8oXZ/683/ACdbFUF+Wmk2o/Smquga7e9mhjc7lI1NSF8O RbfFARmoIsX5laTKgAe4spo5SO4SrCuKWW4qxOX/AMmlD/2xz/1ENiqE8+6bDqXmXytZT7wyy3Pq r/MqiJmX/ZBaYqmP5iW0B8k36cFCRJGYlAoF4yKBxp022xVMvLemWljoNpaxICjQq0xIqZHdauz1 6licVSf8sRx8rhB9lLmdUHgA/QYqEJ+XWl2ovNe1MoDcnUZ7dGI+yiEMePhyL7/LFCy60izvfzUX 1o1ZIbFbtkP2XkR/TRmHcryFPliqM/MNFX9AXIFJ49Wt1R+4DciR9JQYpXat/wCTF0P/AJhbn/iJ xVX/ADIlSPyXqJY/bWNFHiWlUYqv84/8oPf/APMKP4Yqr+TNKtNN8uWKQIA80KTTyU+J5JFDMzHq eu3tirE4bibT9I88NZVjaK7k9IJtw5/CzLTpQGuFDL/KOnWFh5dsY7JV9OSGOVpFG8jOoYuT3rXA lJbuCGw/MrTWsqRnVLecahEuwb01LJIQO5ZaVxVjzXU9v+XWs+ixj9bU5YZZBX4Y3kUP08Rt9OFD 0nS9PstPsIbSyRUtolAQLTfb7RI6k9ScCWD34/Q/mrXotKPpJcaNNeyxR9EuEqFYAdD3/wBlhQyL yDa2lv5S076soAliEsrDq0jbsSe5rtgSl3li1tbbz15nitlCx0tnKqKANIhd/wDhiTiq6+H6G8+2 t6Phs9ej+q3B7C5j/uifdhRR9OKrtIH6Y87ajqp+K10hf0fZnt6p3nYe4rx+RxVluKuxV2KuxV2K oTVF1RrJxpbwx3lRwa4DNHSvxVC79MVY15c8vecNE0eTTobqxYRitmzLKaO0gZ/U6VHEtSnfFUR5 P0DzHozzQ3lxay2UzyTssSv6nqyEd2oOO2Kr/MOg65c67Y6tpM9vFLZxSRcbkOwPqbHZPb3xVkuK sKl8u+eW18a0t3p4uVgNqilJePpcy+4/mqfHFCtrnl7zdfa7a6lbXNkkenPI1ikiycqSqFb1Kdfs 9sUpv5g0i91by1PppkjS8uI0V5NxHzBVmI6mm22Kq2gW+sW2niDVZIJZ4yFia3DKvpKqha8t+VQc VSPy/wCX/N2jWVzZw3Nk0Tc5LUsshIleRW+Pp8PHl074qqeUvL/mXR7i5W7uLSWzu5pbqZYlk9T1 pQB8Jag4/DiqpqGga9/ixdb02e2RGtltJo5w5bgJObceO1dhTfFUR5w0K/1iys47GWKK4tLuO7Vp uRQ+krAD4QT1YYqg9X8ueYbz9F6nBdW8XmDTuYZ+L/V5Fk2K/tMPh9sVQWr+T/NHmG0lXW7+3R0U mztLRZBAJf8AfkjP8Z2qKdsVRWp6J5zv9AGmSXVjzlDx3UnCUAx0X0+Hg2zctvDFU48t2es2enJa 6pLBK8IWOBrcMB6aKFHLl+1tiqVaf5Y1i21jU2mktZtE1WaWS6t2DmYq6MoUHZe4riqjaaB500SM 2eiX1pdaaCfq8eoLJ6kQJrxDRfaHz+7FUw0Dyxc2moTaxq119e1i4X0zIF4xxR1r6cS+Hv8A21VQ mmeT7q3XU9MvJobnQL9pZUi4ss6ySspHxfZovHr474qp2uj+f9LhFjp9/Y3djGOFvLepKJkQdF/d 1VuI8cVTHy75XGnG7ur+4OoapqH+9ly6gAqBQRqvZRiqW23lTzLpPqW2g6tHFpjuzR29zF6jQ8iS Qjd9/H/bVQvkOzNt5o8xoLlr4IbdZbxqfHMVZpemwo9RTtihMvzJW2HlWeaV/TngkjlsnG7eurDi FHiRXFKYeUdHbSfL9raSf70lfVumPUzSfE9flWn0YqnGKuxV2KuxV2KuxV2KuxV2KuxV2KuxV2Ku xV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV5jc/wCEvrU/1T9PfVvUk+sfU/V+r8qnny5/F164 UM08o/4b/Q6f4f4/U+R50rz9Sg5epy+Ll8/1YEsVh/wb/iRPrn6S5fWn+q/XuX1L6zzNfTr35fzb YUPRMCX/2Q== xmp.iid:07d0e97b-c01d-4a20-9892-fadb500e854b xmp.did:07d0e97b-c01d-4a20-9892-fadb500e854b uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:982aef0b-10fd-8e4b-b72c-e2337f4cb029 xmp.did:3fe272f3-c268-46ee-a2e2-08382aa440b3 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:3fe272f3-c268-46ee-a2e2-08382aa440b3 2014-10-14T14:13:53+02:00 Adobe Illustrator CC 2014 (Macintosh) / saved xmp.iid:07d0e97b-c01d-4a20-9892-fadb500e854b 2014-12-02T11:35:18+01:00 Adobe Illustrator CC 2014 (Macintosh) / Print False False 1 159.998833 49.999194 Millimeters Cyan Magenta Yellow Black Groupe de nuances par défaut 0 Blanc CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Noir CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 Rouge CMJN CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 Jaune CMJN CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 Vert CMJN CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 Cyan CMJN CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 Bleu CMJN CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 Magenta CMJN CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 J=90 N=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 J=85 N=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 J=95 N=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 J=100 N=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 J=85 N=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 J=90 N=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 J=100 N=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 J=100 N=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 J=100 N=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 J=100 N=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 J=95 N=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 J=75 N=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 J=45 N=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 J=0 N=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 J=0 N=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 J=5 N=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 J=25 N=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 J=0 N=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 J=0 N=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 J=35 N=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 J=50 N=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 J=20 N=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 J=40 N=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 J=50 N=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 J=60 N=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 J=65 N=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 J=65 N=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 J=75 N=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 J=80 N=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 J=90 N=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 J=100 N=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 J=80 N=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 Gris 1 C=0 M=0 J=0 N=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 J=0 N=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 J=0 N=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 J=0 N=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 J=0 N=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 J=0 N=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 J=0 N=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 J=0 N=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 J=0 N=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 J=0 N=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 J=0 N=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Couleurs vives 1 C=0 M=100 J=100 N=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 J=100 N=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 J=95 N=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 J=100 N=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 J=0 N=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 J=0 N=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 11.00 endstream endobj 533 0 obj<> endobj 534 0 obj<>stream HMn0=.i9H A.IxKcEԸR|.z^d;?" Gbf$KXk[RUAO瓹mv{}'=/g]վmB%QǜUA3F2eYU5.T$eg4 j\}bUDs޶-kO kfY'S>&ё4E3š6lĤ^M~42hYb6X=?/"$rf}NbLH/t.YA/zn̦|!|8~Jr0P&I'*1H9Po(."vQ -jh`0Ir#캠]`%6in |>t'o-aAcqpqC endstream endobj 535 0 obj<> endobj 536 0 obj<>stream application/postscript Print 2018-04-03T19:09:44+08:00 2018-04-03T19:09:44+08:00 2018-04-03T19:09:44+08:00 Adobe Illustrator CS6 (Windows) 256 256 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A7ZoWhQ+cI5Ne115bi2nl kWwsBI6QxwoxQGilTyquKpt/yrLyR/1bf+S9x/1UxV3/ACrLyR/1bf8Akvcf9VMVd/yrLyR/1bf+ S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLyR/1bf+S9x/1UxV3/ACrLyR/1bf8Akvcf9VMVd/yr LyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLyR/1bf+S9x/1UxV3/ACrLyR/1bf8Akvcf 9VMVd/yrLyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLyR/1bf+S9x/1UxV3/ACrLyR/1 bf8Akvcf9VMVd/yrLyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLyR/1bf+S9x/1UxV3/ ACrLyR/1bf8Akvcf9VMVd/yrLyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLyR/1bf+S9 x/1UxV3/ACrLyR/1bf8Akvcf9VMVd/yrLyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLy R/1bf+S9x/1UxV3/ACrLyR/1bf8Akvcf9VMVd/yrLyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBV MVd/yrLyR/1bf+S9x/1UxV3/ACrLyR/1bf8Akvcf9VMVSrXdCg8nwpr2gvJb29vLGL+wMjPDJC7B Ds5Y8qt1xVNfyy/5QjTf+e//AFESYqyfFXYq7FXYq7FXYq7FXYq7FXYq7FXYqtkkjjRpJGCIoqzs QAAO5JxVjWpfmf8Al/prFLrXrTmOqwv65G9KEQiSh9sVSOf8/Py0jZgl/NMF6MlvMA21duaofvxp bdB+fn5aSMoe/mhDdWe3mIXau/BXP3Y0tp3pn5n/AJfak/C11205nosz+gT2oBMI6nFWTRyRyxrJ E4eNwGR1IKkHoQRiq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYqxj8zf+UI1L/nh/wBREeKu/LL/AJQj Tf8Anv8A9REmKsnxV2KuxV2KuxV2KuxV2KuxV2KpdrvmHRdBsGvtXvI7O2XYNId2P8qKKsx9lGKv EvN//OSF5Kz23la0FvH0F/dgNIfdIgSi/wCy5fIYaRbyXXPNPmPXZjLq+oz3rVqFlclF/wBVBRF+ gYUJVirsVdirsVTXRPNPmPQpRLpGoz2TVBKxOQjU3+JD8Df7IYq9a8of85IXkTJbearQXEXT6/aA LIPd4iQjf7Hj8jgpNvbdB8xaJr9gt/pF5HeWzftId1P8rqaMjezDAlMcVdirsVdirsVdirsVdirs VdirGPzN/wCUI1L/AJ4f9REeKu/LL/lCNN/57/8AURJirJ8VdirsVdirsVdirsVdirsVYJ+Zf5r6 R5NtzbxhbzXJVrBZA/CgPSSYjovt1P44q+Y/MnmnXfMmotqGsXTXM5qEU7JGpNeEadFX5ZJilOKu xVekUshoiM3yBOKqy6det0iP00H6zirm069XrEfoof1HFVF4pYzR0ZfmCMVWYq7FU28t+aNd8t6i uoaPdvbTigcDdJFBrwkQ7MvzxV9N/ln+bGk+crf6tKFs9diWs9lU8XA6yQk9V/yeo/HIsmeYq7FX Yq7FXYq7FXYq7FXYqxj8zf8AlCNS/wCeH/URHiq38sz/AM6Rpv8Az2/6iJMVZRXFXVxV1cVdXFXV xV1cVdXFXVxVgn5rfmXb+TtIEdsVl1y8UiygO4RehmkH8o7Dufpwq+Vr+/vNQvJr29ma4u7hjJNN IaszHqScLFD4qiLWynuT8Aoo6uegxVNrfSrWKhYeo/i3T7sVRgAAoBQDoBireKuxVogEUIqD1BxV B3GlW0tSo9N/Fen3YqlN1ZT2zfGKr2cdMVQ+Koiwv7zT7yG9spmt7u3YSQzRmjKw6EHFX1R+VH5m QectKMVzxi1yzUfXIV2Dr0E0Y/lP7Q7H6MDJnlcCurirq4q6uKurirq4q6uKurirF/zMP/Okal/z x/6iI8VW/lqf+dJ07/nt/wAn5MVZPXFXVxV1cVdXFXVxV1cVdXFUu8w67Y6Dot3q983G2s4zIw7s eiovuzEKMVfHvmjzJqPmTXLrV9Qas9y1VQElY0H2I0r+yo2yTFKcVej/AJT/AJT3Pmy5XUtSVofL 8DUZhVWuGU7xxnsv8zfQN+gSA356srSx826lZ2cSwWtvKI4YUFFVVUAAYUFIsVdirsVdirsVdiqe +RbK0vvNum2d5Es9rcSmOaFxVWVlIIOKhd+bP5TTeVJv0npfOfQZ3I3BLWzE7I57of2W+g79Qmnm uFCa+V/Meo+XNctdYsGpPbPUoSQsiHZ43p+yw2xV9h+XtesNe0W01exblbXkYkUHqp6Mjf5SMCpy LJMa4q6uKurirq4q6uKurirq4qxj8yj/AM6TqP8Azx/5Px4qt/LY/wDOl6d/z2/5PyYqyWuKurir q4q6uKurirq4q6uKvFvz/wBQ1PUUt9D0795b2hFxfxqTzaQr+7UCm/FG5dd+Q8MIQXgjKVJVgQRs QeowoZN+Xnky482+ZYNNUlLRP31/OP2IVI5UO/xN9lffAr630+xs9PsoLGyiWC0tkEcMKCiqq7AY GT5v/Mb/AJTjWP8AjOf+IjCGJY5hV2KuxV2KuxV2Ksj/AC5/5TjR/wDjOP8AiJwFQ+kL+xs9Qspr K9iWe0uEMc0LiqsrdQcDJ8k/mL5LuPKPmWbTmLPZyD1rCdv24WO1f8pT8Lff3woYvhQ9r/5x083m K8u/K9y/7u4BurCvaRQBKg/1kHL/AGJ8cBSHvVcCXVxV1cVdXFXVxV1cVdXFWNfmSf8AnS9R/wCe P/J+PFVn5cH/AJ0zTv8Ant/yfkxVkvLFXcsVdyxV3LFXcsVdyxVZLNHFG8sjBY41LOxOwAFSTirw bUL2W+vri8l2kuJGkZa148jXiK9l6DChItY8u2Gpgs6+lcdp0G/+yH7WKvWPyW8nr5e8rmeUA32p yGWWShH7pCVhAr241f8A2WKvQeWBL5r/ADF/5TfWP+M5/wCIjJMSxzFXYq7FXYq7FXYqyP8ALr/l N9H/AOM4/wCInFQ+lOWRZPOvzx8qprfk6W+iSt9o9bmIjcmHb11+XEc/9jhQ+YsKEz8s61LonmDT 9Wirysp0lZRtyQH41/2S1GKvsyKaOWJJY2DRyKGRh0KkVBGRZL+WKu5Yq7liruWKu5Yq7lirGvzH P/Omaj/zx/5Px4qs/Lo/86bp/wDz2/5PvirJK4q6uKurirq4q6uKuriqS+c7trbyvqEijkWj9Eg+ EzCIn6A+KvGcKFS2t5bm4it4RWWZ1jjHizGg/E4q94t4Ybe3it4V4Qwosca+CqKAb+wwJVK4q+bv zE/5TbV/+M//ABqMkxLHcVdirsVdirsVdirIvy7/AOU20j/jP/xqcVD6RrkWSyeKKeGSCZQ8MqlJ EPRlYUIPzGKvjHWtNk0zWL7TZPt2VxLbsfExuVr+GSYoLFX1v+WWpNqPkHQ7ljVhbLCx61MBMJP0 +ngSyeuBLq4q6uKurirq4q6uKsb/ADFP/Om6h/zx/wCT6Yqt/Ls/86dp/wDz2/5PvirI+WKu5Yq7 liruWKu5Yq7lirFvzIndPLnBWoJp40YeIAL0+9a4oeV4VTPyxCZfMWnKBWlxG/8AwDc/+NcVe1cs CXcsVeG/mFpsFz5o1FqcJeYo4/1F6jvhYlg91Zz2z8ZF2P2WHQ4VUcVdirsVdirsVZJ+W/8Aym+k /wDGVv8Ak22AqH0ZywMncsVfKX5tWv1b8xdbjoBymWXb/i6JJP8AjfCgsRwofTX5FXJk/Lu0jqT6 E88YB7VkL7f8HgKXoPLAl3LFXcsVdyxV3LFXcsVY5+Yh/wCdO1D/AJ4/8n0xVZ+Xp/50/T/+e3/J 98VZHyxV3LFXcsVdyxV3LFXcsVYt+Y8bP5dDAVEc6Mx8BRl/42xQ8uwqmfliYw+YdOcGhNxGn0O3 D/jbFXs/LAl3LFXjfnT/AJSjUP8AXH/EFwsSkUkaSIUdQynqDiqT3ujOlXtqsvePuPl44VSsgg0O xHUYq7FXYq7FWSflx/ym2lf8ZW/5NtgKh9E8sDJ3LFXyr+bN19a/MTW5ag8Zli2/4qiSP/jTCgsR wofTH5GQmL8vLV6EevPPICe9JCm3/AYEvQOWBLuWKu5Yq7liruWKu5Yqxz8wj/zp+of88f8Ak+mK rfy+P/OoWH/Pb/k8+FWRcsCHcsVdyxV3LFXcsVdyxVJvOFu9z5av40IBWMSmvhEwkb8FxV5DhVUg nkgnjniPGWJldG8GU1B+/FXt9vcxXEEc8R5RSoskbeKsKg/dgVU5Yq8d85/8pPf/AOuP+ILhQUlx V2Kq1l5Ou/MExS0i4sNnuTtGv+ue/wAuuKpF5j8q6z5fuvR1CGiMSIblPiikp/K38DvhVKMVdirI /wAuf+U10r/jK3/JtsBUPoflgSpzXEUEMk0rhIolLyOegVRUk/IYq+O9a1F9T1i+1F/tXlxLOQe3 qOWp+OSQgsVfWH5bWDaf5E0S2bZjbLMw6UM5MxH/AA+BLJeWBXcsVdyxV3LFXcsVdyxVjv5gn/nU L/8A54/8nkwpWeQD/wA6lYf89f8Ak8+KshrgQ6uKurirq4q6uKuriqyaOOaJ4pAGjkUo6noVYUIx V4re2slpdzWsn95A7RsexKmlRXscKqOKvS/IGr/WtJNnI1Z7I8RXcmNqlDv4br92KsorgV5D5y/5 Sa//ANcf8QXCgpMqszBVBLE0AG5JOKsz8u/l9NPxudWrDD1W1G0jf6x/ZHt1+WK0z+2tre1gWC2j WKFBRUQUAwJW3tlZ31s9reQpPbyCjxyAEH+33xV5P5v/AClubXneaByubfq1kd5U/wBQ/tj2+188 Nop5yysrFWBVlNGU7EEdjhVkX5d/8pppX/GRv+TbYCofQdcCWA/nP5oXR/KEtpE9L3Vq20ag7iIj 983y4/D/ALLCr5swoTLy5o8us69YaXHUNeTJEzDfipPxt/sVqcVfXsaJFGkcYCxoAqKOgAFAMild XFXVxV1cVdXFXVxV1cVY95/P/OpX/wDzy/5PJhSs8hH/AJ1Ox/56/wDJ58VZBXFDq4q6uKurirq4 q6uKurirz78wtKMV9HqSD93cgJKfCRRt/wAEo/DFWI4qj9E1abStRju4/iA+GWPpzQ/aX+I98Vet Wl5Bd20dzbuHhlHJGHh/Ud8VedaxoWo6t5rvo7SOqCRfUmbZE+Bep/h1xQy7QPKenaQokp695T4r hx0/1B+z+vFKe1xV1cVdXFXVxVi/mzyDo/mBWm4/VdRp8N3GPtH/AIsXbl+v3xV575e8r6xoHnzS 4b+GiNKwhuE3ikpG32W/gd8UPZLy+trK0mu7uRYbaBDJNK3RVUVJOKXy55/84T+afMM1+apZx/ur GE9ViU7E/wCUx+I/dihjeFXr35B+WGlvbrzHOn7u3BtrInvI4/eMP9VPh/2RwJe31xV1cVdXFXVx V1cVdXFXVxVj/n0/86nff88v+TyYpW+RD/zqlj/z1/5PPiqfVwIdXFXVxV1cVdXFXVxV1cVQmq6f DqNhNZy7LIPhburDdWHyOKvJb2zns7qW1nXjLExVh2+Y9j1GFVHFU98seZ5dIlMUoMljIayRjqp/ mX+IxV6RaXdrdQLcWrrJDJuHXv8AP3+eBVauKurirq4q6uKurirq4qpXdza28DXF06xwxfEXfoD0 FPfwxV5b571j/E1u+nq0kGnAhlCmjOy9GfsR/k/x6FXkWseXb/TWLOvq23adBt/sh+zhQs8vaFfa 7rFtpdivKe4anI/ZRRuzt7KN8VfVGg6PZaJpFrpdmtLe1QIp7serOfdmJJyKUfXFXVxV1cVdXFXV xV1cVdXFUh89n/nVL7/nl/yeTClZ5FP/ADqtj/z1/wCTz4qn1cUOrirq4q6uKurirq4q6uKurirH /NnlwapALi3AF9CKL2Ei9eJPj4Yq84dGRijgq6khlIoQR1BGKtYqjtK1rUNLl9S0kop+3E26N81/ iN8VZtpfnrTLkBLsG0m6VPxRk+zDp9I+nFWQw3EE8YkgkWWM9HQhlP0jFV9cVdXFVk1xDBGZJpFi jXq7kKo+k4qx7VPPWl2oZLSt3MNqr8MYPux6/wCxBxVhWq63qOqS87uSqj7EK7Rr8l/id8VQGKuE ZlIiCGQyHgIwORYttxA718MVZ/5H8kaf5djmulgSPUbynrld+CdfTU7gCu7U2r8hirKa4q6uKuri rq4q6uKurirq4q6uKpD56P8Azqt9/wA8v+TyYpWeRz/zq9l/z1/5PPiqe1xQ6uKurirq4q6uKuri rq4q6uKuriqQeY/K0Gp1uLciG9A3b9mT2anf3xVgF1aXNpO0FzGYpV6q36x4j3xVRxV2Kr4ppoXE kLtG46MhKn7xiqNi8wa5GarfTE/5Tl/+JVxV0vmHXJTVr6Yf6jlP+I0xVBSzTTOZJpGkkPV3JYn6 TiqzFXYqrWlndXk6wW0Zllboq/rJOwHucVegeXPK8GlgXExE18RTmPspXqEr+vFU+rirq4q6uKur irq4q6uKurirq4q6uKpF54P/ADq97/zy/wCTyYpW+ST/AM6xZf8APX/k6+KE85Yq7liruWKu5Yq7 liruWKu5Yq7liruWKu5YqhNQ02x1CH0ruISAfZboy/6rDcYqxDU/I97CS9i4uI+0bUWQff8ACfw+ WKscuLa4t39O4ieJ/wCV1Kn8cVU8VdirsVdiqrb2tzcyenbxPM/XiiljTx2xVkWm+RryUh7+QW8f eNCGkP07qPx+WKsw0/TrHT4fStIhGp+0erMfFmO564qiuWKu5Yq7liruWKu5Yq7liruWKu5Yq7li ruWKpH52P/OsXv8Azy/5OpiqzyUf+dZs/wDnp/ydfFU85DFXchiruQxV3IYq7kMVdyGKu5DFXchi ruQxV3IYq7kMVdyGKrJY4ZkMcyLIh6o4DA/QcVS2fyxoMzFmtFVj/vssg/4FSF/DFUE/kfRmNRJO nsrL/FTirk8j6MpBZ53HgzLT/hVGKo2DyzoMLBltFZv+LCzj7mJH4YqmUUcMSCOJFjjXoigKB9Ax VfyGKu5DFXchiruQxV3IYq7kMVdyGKu5DFXchiruQxV3IYq7kMVSPzqf+dZvP+ef/J1MVW+TD/zr Vn/z0/5OviqdcsCu5Yq7liruWKu5Yq7liruWKu5Yq7liruWKu5Yq7liruWKu5Yq7liruWKu5Yq7l iruWKu5Yq7liruWKu5Yq7liruWKu5Yq7liruWKu5Yq7liqS+cz/zrV5/zz/5OphVZ5OP/Ot2f/PT /k62Kp1XArq4q6uKurirD/Pn5jWXlhVtooxdapKvJIK0RFOwaQj8FHX2wqwuHzF+dWpw/X7KF47V xyRUggVSp6FBMC7D78VRGgfm/rFlqQ07zXbcAGCS3AjMUsRPeSPoR/qgfTirLvzI8z6honluLUdK lT1JJ40WQgSKUdGao7b0G+Ko7yHrV9rPlSx1K+ZWup/V9RlUKPgmdBsP8lRirIK4FdXFXVxV1cVd XFXVxVSupWjtZpF+0iMy/MAnFXnH5X+fPMPmHWbq11OSN4YrcyoEjCHlzVeo9mwq9MrgV1cVdXFX lXnL8z/MMHmWTQ/L8CF4nWHk0ZklklNKhVrSm9OmFWceTLzzHc6KsnmCH0NREjqU4hPgFOJoCRiq e1wK6uKurirq4q6uKurirq4q6uKpL5xP/Ot3n/PP/k6uFVvk8/8AOuWn/PT/AJOtgVOeWKu5Yq7l iruWKvCPKMC+bvzHkvL9fWg5yXkkZ3UpGQsSGv7IJQUPbbCr3flgViHnf8u7LzTcW1ybn6ncQKyP IsYcyKSCoPxL9nenzxVIfzO01tL/AC40/TmnNz9UuIYhMw4llWOQLtU0oNsIVj3lPWPzBv8AQbbR /LEQgtrAOLm8PD4nllaSnKTYUDjZRXviqO0D8wvN2j+Zo9F80N6sbyLDN6ioHiMlOLh46Bl3B77d MVZ356862/lfTFm4Ca+uCUtIDsCQPidv8laj/PfArALbVfzo1W2/S9nzW1I5woqW6Bl6/BG45uPD rXtXCrJvy7/MebXJ30nVo1h1aMExuo4iUJ9oFT9l16n+FMVUfzC/Mq60m+Gi6IiyakePrTFefpl6 FURP2nII/wA+iqRXN7+dWm2batcuzW6DnNGVtnKpsatGoqo8abjvTFWY+TvO6eaPL940qLDqFrGy 3US14HkrcXSpJoafRirAvyRkSLzBqEkjBI0smZ3Y0AAkQkknEqnGrfmR5k1vzCmleTFHpISDcMit 6m9DIeYISNe3f9WKvStLhvoLCKO/uvrl4B++nCLGCx68VUAADtgVDeZzrv6Duf0Dx/SvwfVuXCn9 4vP+8+H7HLrirweL/Fv+Ojw4/wCJfXav93x9XieXX930woet3fm3UvLXkyC+8xqJdcdnjECFAHkL sU3j+EKI6EkfrxSw2w1n83vM0T6hpsggswSIwgiiQkdQhkq7fMmmKo7yt+Z+uWuufoPzZGBK0gh+ sFFjeOQmg9QLRCh/mA99xiqa/mv5u13y/wDov9FTrD9Z9f1qoj19P0+P2wafbOIVix88/mV5kkP6 BhkjtoQqO0MaGrAbl5HHEE9eIpir2W3aT6vF6v8Ae8F9T/Wpv098CqnLFXcsVdyxVJvOB/51y7/5 5/8AJ1cVW+UD/wA67af89P8Ak62KU4rirq4q6uKurirwz8sp/wBCef5LC6ojyiaxYttRwwYD/ZNF QfPCh7nXAliXnr8wYfKslpELQXs1yHdo/V9IoqkAE/A9eRJp8sKLSH8zNSk1P8udP1CSD6s13PDN 6HLnxDxyFfiotdvbFU3/AChVV8k25UAF5pmY+J50r9wGJUMI/NKn/Kw7Q+MdtX/kYcQrf53SSHzN ZRk/u1slZQenJpZA3/ERiFLII7/86o41jj0i0REAVFDQAADYAD1sVSfSPKHn4+drXXr7Tlt+Vyst 28UsAUK20hCiRm3UmuKoXy+I5/zln+tUfjfXhjD7/FGJPT6/y8RTFXtMwieF1mAMTKRIG+zxI3rX tTAlj2l6f5OtIL5tAFqJngYTfVpBIeIBpUBm74oeF+XbDX9SuZtO0ZXaS6jKXIU8VMQIYh27LUD5 9MkhnH5N65a2Oo3eh3cKwXdy3KKZhxkLx7NC1fChKjxrgKQ9grgS6uKvFLX/AMnS3/MbJ/ybbChM Pz1eU3Gjoa+kEnKjtyJSv8MQpemeX4raHQtPjtafVltovSK9CvAEH6euBLyb87ordPMFjKlBcSW3 72ncK5CH9eEIKI/OWSWTTvLMk3968MzSf6xWAn8cQpejeTLK3svKulw26BVNtFI9O7yIHdj82bAq dVxS6uKurirq4qk/m8/867d/88/+Tq4qt8pH/nXrT/np/wAnGxVN64odXFXVxV1cVea/mN+XV7f3 p1zQx/puzXNup4MzJ0kjO3xbbj+OFUjh/M38wNPhFld2Cy3K/CJLiCVZdv5gpQE/Riqlo/k3zV5v 1sap5gWWC0JBmklUxsyDcRwoaUHvSg67nFWafmtpl3deU4LTTbSSdo7mLjBbxs5VFRx9lAdhtiqM /LCzvLLyhbW95BJbTrJKWimRo3ALkiqsAcVYd+Y+ia1d+ebW5tLC5uLdUtw00UMjoCrkmrKCNsVZ L+ZvkmfzDZw3dgAdSswwWMkD1Y2341OwIO4+nFWLaf8AmH570m0TTLvR2nuIEEcLzRSrJQbLyC/b 27ilfHFUx8i+VfMl75hbzP5iDwNyaSK3kqrPIw4gmP8AYVB0B36Yqh/zA8l65Z+YB5m8vxvKS6zS RxDnJHMvVgm/JWpU/T2xVB6j+YnnbV9Ok0qDSGiublTFLLDHKzFW2YKprxr474qyr8vvJlzoGgXs l4v+5K/T44lo3BFU8EqP2qsSafwxVIvyd0bWNP1W/e/sbi0R4FVGnieME8waAsBXEq1+Z3kvUo9X h1/QreWSaZwbiO2RmkSdN1lUICfipufH54q9B8ratfanosFxf2ktnfAencwzRtEea9WUMB8LdR93 bAqbVxV5Nb6Bri/mwdRNhOLD63I/1r029PiUIB5UpTCrMPzC8oN5l0dY7cquoWjGS1Ztg1RR4ye3 Kg38QMVYFpPnHz55WsxpF3pLTJDUW5mjkqq+Cunwug7U+/FW9F8peZvN3mP9M+YYWtrPkryCRDHz RD8MMaH4uPav4k4qnX5zaTquofof6hZT3fpfWfU9CJ5ePL0qcuANK0NMQrPPL6SRaDpsUqGOSO1h V0YEMrCNQQQehGBUfXFXVxV1cVdXFUo82n/nXrv/AJ5/8nFxSs8pn/cBa/8APT/k42FU3rih1cVd XFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxVD3eo2FmqteXMVsrmiGZ1QEjw5EYqqQ3EM8SzQSLL E4qkiEMpHsRscVVK4q6uKurirq4q6uKurirq4q6uKurirq4q6uKurirq4q6uKuriqUebD/uAuv8A nn/ycXFK3yqf9wNr/wA9P+TjYoTauKurirq4q6uKuriqyaeKGJ5pWCRRqXkdtgFUVJPyGKoTTdc0 jVPU/R93Fdejx9X0mDceVeNaePE4qu1LWdL0xEfULqO1SQkRtKwUEjcgVxV0utaVDp66jLdRpYuF K3JYBCG2Xf3xVCzebfLcNml7JqUAtpCRHJzB5FTQ8QNzT2xVvSvNXl7VpPT0+/inl6+kDxcgdSEb ix+7FU1riqS3/nTytp9wba71KGOcGjRglyp8G4BuP04qwf8AN7UrDUNG0q4sbiO5gM0gEkTBhXgN jTofbFWY/l+f+dN0r/jD/wAbHFUffeZvL9hL6N5qNvBMOsTyKGHzWtRiqIsNV03UIzJY3UV0g6tC 6vSvY8SaYqwn81/MNvDo/wBRs7/0tTiuIzLDFIVlCFGO/Eg0+IYqjfy28x6fP5d06wnv1l1ZvW5Q vJymNJZHFamv2N/lirK77UrGwgNxe3EdtCNvUlYKK+Ar3xVL7Dzj5Yv5xb2mpQSTN9mPlxLHwXlS p9hiqcVxVJtQ85eWNOlMN3qUMcq15RhubKR2ITkQfniqL0zXdI1RC+nXcVyF+0I2BYfNeo+nFUdX FXVxV1cVdXFXVxV1cVSnzUf9wN1/zz/5OLiq3ysf9wVr/s/+TjYqU1rgV1cVdXFXVxV1cVS/zEf+ df1P/mEn/wCTbYVeffkif+O1/wBG3/M3EoRH51n/AHHaZ/xmk/4iMQrXmA/8gfsv+MVr/wASGKUp /LfyNYa3aSajq/Oa1icwW1sGZQafEzEqQaVbYA9a4oW/mF5Jt/LottY0V5IIfVCMnIlopN2Rkcnl T4cVZDrHna8P5aW+qxv6d/fUtTKhoVkBYSOKdCRGxHhXFKTeQfy40/VtLGrau0jpOzfV4EbiCqkq Wcjfdht/bihKPzE8nReXbiB7GR2067qVjc1KSJ1HauzbfTirO9JGtv8AljZx6IP9yMkASJuSoVBk PNgW2rxrTFKQaB+WFjFbS3Pmyf6vMzH0ohOijiNy7PvUk++KEjjfT/L/AOYFougXjXFiZoo3ZXDA rIwWSPkvwuP8+2Ksj/Nvy3pkVo+vIH+v3M8UUhLfBxEZXZaeEYxVF/lj5S0f9F6b5ipJ+kf3+/L4 PtyQ/Zp/JirFLm8HnTzk66hfLZ6VCX9JndUVYUNAE5Hjzk2r/QUxVMPNfkvydbaRJd6LqkZu7Ycz A1xHJ6ijrQDflTcUxVMtB806vqH5caqEmc6ppyGMTgnmYiAQ3Ib8gnIV9q4pYn5JXyLKbhPMxcTu R9XdmkWMDvvFvyr/ADbYoZVpfkCa31+LWPK+q276dHIjBfUZ2KbF4mMYIIPvir06uBLq4q6uKuri rq4q6uKpV5pP+4K6/wBh/wAnFwqFvlc/7grb/Z/8nGxVNa4FdXFXVxV1cVdXFUBr4Z9C1JFFWa1m CgdyY2xV5v8Akte28d5qdo7hZ7hIXhU/tCIvyp7jmMJQrfnPqNq/6PsEcNcxs8sqA7orABeX+tiE ojzAf+QQWX/GK2/4kMVXfk/r1mdNm0eSRUu45WlhRiBzRwK8fEqRviVVPzg1m0TSIdKV1a7mlWVo walY0B3PhUkUxCpPqmj3SflFp5KnlFOLyVSNxHIZFU/dIpxQyn8rdas7vyzBYo4F3Y8kmi2B4s5Z XA8CGpXxxSxv85NZs55LLS4ZBJPbs8twFNQhYAKp9+pxCou+1zUNI/KrS5bFzFPccbczD7SK3qMS p7H4KVxVDeS/y/0XW9Ij1jU7qa6nnZucavQIVYijndi1BXqOuKsd1qDQ7Pz1bW+jlRY289spZXLr zDKXPMk1364oZ9+b9T5Ujp2uo6/8A+ISjfywljbyTYKrBmjMyuAalSZnah+gg4q8u8t6Nox80y6R 5gZoY1MkKOG9MCZG+Hkx7MAQPemKGc635A8g6Np8t9fG4WKMbKJRzduyoCBVjilU8o6n5U0ny7qe s6VaXwsY3RbhZRGzsVoPgAelF9SrVOKqeneX/wAvfOUE13Y2stjLG/GVIysTioBDemDJGFPYgYqw 3zFp0vkrzHD+idQMkioJQdg61JHpygbEED6fDFD3KKQvEjkcSyglT1FRWmBK+uKurirq4q6uKuri qVeaD/uCuf8AYf8AJxcKrPLJ/wBwlt/s/wDk42KlNOWKu5Yq7liruWKu5Yq6uKvO9Y/KG1nvHuNM vTZo7Fvq7pzVSd/gYMpA8B+OKr1/J7ShYiFr6RrouGe5CAVABHFUqaDevU4qiPPenppv5dfo9HMi W3oRq52JCuBWgxVjPlDyDp/mLy2bozvaXsdxJGJlHNSoVSAyEr0J7EYoT3S/yf063u1n1C+e+iU8 vQEfpBj/AJZ5uSPlTFLPpYIJbdreSNWgdTG0RA4lCKFaeFMVef335O2T3TS6fqUlnExqImj9UrXs GDxmnzxVePye0r6mInvpWui4Z7niNwARxCVNKk16nFWSHyjpsvliLy/ds01vEtEmFFcMCSrr1AIr irEv+VNRrIeGsOsJO6ej8RHgWEgH4YoRN9+T2kyQQJZXsltLGCJpZFEvqEmoNAY+NPbFLI28pWk/ lWPy9eTNNHGgUXIHF+atyDgEtTFUk8ufljFomu2+qJqJnFvz4wmIKTzRk+1zPTl4Yqj/ADX+Xuk6 /N9b5tZ35ADToAwcAUHNDSpHjUYqx+1/JtPVU3uqtLAh2jjj4kr/AKzM3H7sUM/tNK06001dNggV bJUMfo0qCrfa5V68q71xSwa+/KGAXLT6TqclmrV4xOpegPYOrIafMHFUXoP5V6XYXiXmoXLajOjc 1RlCR8vFlJctv7/RirOeWKu5Yq7liruWKu5Yq7liqV+Zj/uEuf8AYf8AJxcVC3y2f9wtt/s/+TjY qUzrirq4q6uKurirq4q6uKurirq4qlnmLRLfXNLk06eR4o5GVi6U5fAa964qs8s+Xrby/pzWNvK8 0bSNKWkpWrACmwH8uKptXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV 1cVdXFXVxVLPMh/3C3P+w/5OLioW+XD/ALhrf/Z/8TbFSmVcVdXFXVxV1cVdXFXVxV1cVdXFXVxV 1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxVLfMZ/3 DXH+w/4muKhfc21x5anl07UYnS2R2NpdhS0bxs1RuK0O+4xSQpf4j0f/AJaP+Ef/AJpxRTv8R6P/ AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8 R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04 rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/ AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH /CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/ AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8 R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04 rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rSrb29x5lmj07Tone3kdTd3ZQrHHGrVO5pvt sMU0/wD/2Q== xmp.iid:5B0DF43F2F37E811B301980F8332B901 xmp.did:5B0DF43F2F37E811B301980F8332B901 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:e4605c3c-53b1-4c1c-b17e-d25e6ce6c450 xmp.did:0980117407206811822A897E387FE54C uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:5B0DF43F2F37E811B301980F8332B901 2018-04-03T19:09:44+08:00 Adobe Illustrator CS6 (Windows) / Print False False 1 210.001652 296.999959 Millimeters Cyan Magenta Yellow Black Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK Red CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK Yellow CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK Green CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK Cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK Blue CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK Magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 14.999998 100.000000 90.000004 10.000002 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000004 84.999996 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000001 94.999999 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000002 84.999996 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000001 0.000000 90.000004 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 19.999999 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 84.999996 10.000002 100.000000 10.000002 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000004 30.000001 94.999999 30.000001 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000001 10.000002 44.999999 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 69.999999 14.999998 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 84.999996 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 94.999999 5.000001 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000002 100.000000 35.000002 10.000002 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000002 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 94.999999 19.999999 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 39.999998 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 39.999998 44.999999 50.000000 5.000001 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000002 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000001 60.000002 64.999998 39.999998 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 39.999998 64.999998 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000001 50.000000 75.000000 10.000002 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000002 60.000002 80.000001 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 39.999998 64.999998 90.000004 35.000002 C=40 M=70 Y=100 K=50 CMYK PROCESS 39.999998 69.999999 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 69.999999 80.000001 69.999999 Grays 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999402 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998797 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999701 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999102 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999402 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998803 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999701 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999102 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998803 Brights 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000002 94.999999 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 84.999996 10.000002 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000004 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000002 90.000004 0.003099 0.003099 Adobe PDF library 10.01 endstream endobj 537 0 obj<> endobj 538 0 obj<> endobj 539 0 obj<> endobj 540 0 obj<> endobj 541 0 obj<> endobj 542 0 obj<> endobj 543 0 obj<> endobj 544 0 obj<> endobj 545 0 obj<> endobj 546 0 obj<> endobj 547 0 obj<> endobj 548 0 obj<> endobj 549 0 obj<> endobj 550 0 obj<> endobj 551 0 obj<> endobj 552 0 obj<> endobj 553 0 obj<> endobj 554 0 obj<> endobj 555 0 obj<> endobj 556 0 obj<> endobj 557 0 obj<> endobj 558 0 obj<> endobj 559 0 obj<> endobj 560 0 obj<> endobj 561 0 obj<> endobj 562 0 obj<> endobj 563 0 obj<> endobj 564 0 obj<> endobj 565 0 obj<> endobj 1 0 obj<> endobj 2 0 obj<> endobj 3 0 obj<> endobj 4 0 obj<> endobj 5 0 obj<> endobj 6 0 obj<> endobj 7 0 obj<> endobj 8 0 obj<> endobj 9 0 obj<> endobj 10 0 obj<> endobj 11 0 obj<> endobj 12 0 obj<> endobj 13 0 obj<> endobj 14 0 obj<> endobj 15 0 obj<> endobj 16 0 obj<> endobj 17 0 obj<> endobj 18 0 obj<> endobj 19 0 obj<> endobj 20 0 obj<> endobj 21 0 obj<> endobj 22 0 obj<> endobj 23 0 obj<> endobj 24 0 obj<> endobj 25 0 obj<> endobj 26 0 obj<> endobj 27 0 obj<> endobj 28 0 obj<> endobj 29 0 obj<> endobj 30 0 obj<> endobj 31 0 obj<> endobj 32 0 obj<> endobj 33 0 obj<> endobj 34 0 obj<> endobj 35 0 obj<> endobj 36 0 obj<> endobj 37 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 38 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 39 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 40 0 obj<>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 41 0 obj<>stream /GS1 gs BT /F6 1 Tf 10.0001 0 0 10.0001 175.748 710.0786 Tm 0 0 0 1 k 0.0161 Tc 0 Tw [(on)-518.7(DSS-induced)-517.4(colitis)-519.7(were)-511.4(found)-511.7(t)-4.7(o)-514.7(a)-1.1(ss)]TJ 19.61 0 TD [(ociate)-517(with)-518.7(PD-1)-514.7(upregulati)-5.3(on)-513(and)-517.4(M)4.7(2)]TJ -19.61 -1.4003 TD 0 Tc [(macrophage)-424.4(polarization.)-427.3(Thus,)-426.3(PD-1-mediated)-427.3(M2)-423.2(macrophage)-430.1(polarization)-425.2(is)-421.2(a)-425.4(key)]TJ T* [(mechanism)-301.1(of)-303.5(helminth-induced)-305.3(modulation)-302.4(of)-303.5(the)-300.8(host)-301.4(immune)-303.4(system.)]TJ /F1 1 Tf 6.9999 0 0 6.9999 175.748 663.1368 Tm 0.0125 Tc [(Ke)12.5(yw)12.5(o)-5.1(r)12.5(ds)12.5(:)-506.7(i)3.3(n)]TJ /F10 1 Tf 6.4307 0 TD 0 Tc ()Tj /F1 1 Tf 0.6074 0 TD [(a)-11.1(m)-12.1(ma)-15.2(to)-16.8(ry)-522.4(bo)-15(wel)-528.5(di)-12.6(s)-11.6(e)0(a)-14.2(s)0(e)-14.7(,)]TJ /F2 1 Tf 13.2097 0 TD 0.0106 Tc [(T)10.6(r)-4.7(ic)10.6(hine)10.6(lla)-502.7(s)10.6(pira)10.6(lis)]TJ /F1 1 Tf 8.8767 0 TD 0 Tc [(,)-515.6(m)0(a)-15.2(c)-11.1(ro)-15.3(ph)-11.7(a)-11.1(g)0(e)-14.6(s)0(,)-519.2(p)-11.5(ro)-15.3(gr)-15.3(am)-15.2(me)-15.2(d)-513.7(d)-11.5(ea)-14.2(th)-523.8(1,)-522.5(ex)-14.7(c)-11.1(r)0(e)-14.9(t)0(o)-16.8(r)0(y)-12.1(/)]TJ -29.1245 -1.4254 TD [(secretory)-304.6(products)]TJ 11.9999 0 0 11.9999 45.3543 613.1337 Tm (INTRODUCTION)Tj /F11 1 Tf 9.5 0 0 9.5 45.3543 593.1211 Tm [(Ep)-10.1(id)-7.7(e)-7.7(m)0(i)-8.2(o)-7.2(lo)-7.9(gi)-10.1(cal)-466.5(st)-8.3(ud)-10.3(i)-8.5(e)0(s)-461.3(a)0(r)-10.6(e)-461.2(in)-10.6(cr)-7.7(e)-7.7(asi)-13.2(ng)-9.5(ly)-461.7(re)-13.7(por)-12.4(ti)-10.9(ng)-463.1(an)-466.2(inv)-12.1(er)-7.7(se)]TJ 0 -1.2114 TD [(as)19.2(s)11.9(o)0(c)20.8(i)0(a)16.7(t)0(i)24.9(o)0(n)-343.5(b)0(e)20.8(t)15.6(we)18.8(en)-338(th)15.4(e)-347.9(p)12.7(re)16.1(va)23.7(le)21.5(nc)20.1(e)-353.8(o)0(f)-336.9(a)13.3(ut)16.4(oi)20(m)12.3(m)12.3(u)0(n)16.7(e)-347.9(di)22.1(se)16.1(a)13.3(s)0(e)16.1(s)-346.2(an)17.2(d)]TJ 0 -1.2055 TD [(h)11.8(e)0(l)21.5(m)0(i)15.7(n)0(t)19.5(h)-226.9(in)19.2(fe)20.7(ct)19.8(io)20(ns)15.8(.)-229.6(T)0(h)17.1(e)0(r)22.1(e)-234.5(h)11.8(a)13.3(s)-232.8(b)0(e)20.9(e)0(n)-224.6(g)0(r)22.3(o)0(w)19.3(i)0(n)19.2(g)-234.2(in)19.2(t)15.6(e)0(r)16.1(e)0(s)22.1(t)-235.1(in)-219.5(ex)18.7(pl)18.1(oi)20(t)15.6(i)0(n)19.2(g)]TJ 0 -1.2114 TD [(th)21.4(e)-306.1(i)15.3(mm)18.7(un)16.7(or)22.6(eg)20.6(ul)18.1(a)13.3(t)0(o)20.2(r)0(y)-294(c)0(a)17.5(p)12.7(ab)18(il)20.7(it)24.9(ie)19.6(s)-304.4(o)0(f)-295.1(h)11.8(el)21.5(m)12.3(i)0(n)19.2(t)0(h)21.4(s)-304.4(to)-290.1(de)17(ve)20.6(lo)21.9(p)-303.5(n)0(o)20.5(v)0(e)20.6(l)]TJ T* [(th)21.4(er)22.1(ap)14.1(i)15.3(e)0(s)-204.7(f)0(o)21.2(r)-208.9(tr)21.5(ea)17.5(tm)21.9(en)20.1(t)-211.2(o)0(f)-199.6(a)0(u)20.1(t)0(o)20.2(i)0(m)21.7(m)0(u)19.1(n)0(e)-200.7(i)0(n)]TJ /F12 1 Tf 16.1186 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(ma)19.7(to)20.2(r)11.9(y)-210.4(di)16.1(s)11.9(e)0(a)17.5(s)11.9(es)-198.7(an)17.2(d)]TJ -16.6378 -1.2114 TD [(al)18.6(le)21.5(r)11.9(g)0(i)19.8(c)-252.4(d)12.7(i)0(s)21.3(e)0(a)17.5(s)11.9(es)-240.5(\()]TJ 0 0 0 0.7 k 6.6838 0 TD (1)Tj 0 0 0 1 k 0.4655 0 TD [(\).)-244.6(U)12.9(l)0(c)21.5(e)0(r)16.1(a)13.3(ti)18.9(ve)-242(co)20.8(li)20.7(t)15.6(i)0(s)-241.3(a)0(n)17.2(d)-249.8(Cr)23.4(oh)22.5(n)]TJ /F13 1 Tf 11.816 0 TD ()Tj /F11 1 Tf 0.2089 0 TD [(s)-250.7(d)0(i)16.1(s)11.9(ea)23.5(se)-240.5(ar)19.2(e)-252.4(t)0(w)24.2(o)]TJ -19.1741 -1.2114 TD [(we)-11(ll)-7.3(-es)-11.8(t)-8.3(abl)-12.5(is)-8.6(he)-7.8(d)-458.7(f)-7.4(or)-7.3(ms)-465.1(of)-462.2(in)]TJ /F12 1 Tf 11.7085 0 TD ()Tj /F11 1 Tf 0.5371 0 TD [(am)-10.2(mat)-12.5(or)-7.3(y)-461(b)0(o)-8.5(wel)-465.2(di)-7.7(se)-13.7(as)-10.6(es)-461.3(\(I)-10.3(BD)-6.9(\))]TJ -12.2456 -1.2114 TD [(ch)22(ar)19.2(ac)17.5(te)19.8(r)11.9(i)0(z)19.6(e)0(d)-317.2(a)13.3(s)-328.2(c)0(o)20.8(m)12.3(pl)18.1(ex)18.7(,)-325.1(i)0(m)21.7(m)12.3(un)16.7(e-)18.1(m)12.3(e)0(d)22.9(i)0(a)16.7(t)0(e)19.8(d)-327.4(d)12.7(i)0(s)21.3(o)0(r)16.6(d)12.8(er)22.1(s)-328.3(\()]TJ 0 0 0 0.7 k 22.3071 0 TD (2)Tj 0 0 0 1 k 0.4655 0 TD [(\).)-316.2(Pr)18.9(io)20(r)]TJ -22.7726 -1.2114 TD [(r)11.9(e)0(s)16.1(e)0(a)23.5(r)0(c)16.1(h)-220.9(ha)19.1(s)-226.8(d)12.8(es)16.1(cr)22.1(ib)20(ed)-215.8(th)21.4(e)-222.5(p)0(r)18.7(o)0(t)20.2(e)0(c)20.4(t)0(i)18.9(v)0(e)-212.1(e)0(f)80.4(f)0(e)20.7(c)0(t)19.8(s)-226.8(of)-211.6(h)11.8(e)0(l)21.5(m)0(i)15.7(n)0(t)19.5(h)-220.9(in)19.2(fe)20.7(ct)19.8(io)20(ns)]TJ 0 -1.2055 TD [(and)-459.4(speci)]TJ /F12 1 Tf 3.9387 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(call)-7.6(y)-449.1(h)0(e)-7.8(lminth-d)-10.6(erived)-460.3(proteins)-462.8(on)-450.9(vari)-8.7(ous)-454(IBD)-455.6(in)]TJ -4.4698 -1.2114 TD [(an)17.2(i)15.3(m)0(a)19.7(l)-281.1(mo)17(d)12.7(e)0(l)21.5(s)-286.5(a)13.3(s)-280.5(we)18.8(ll)-269.8(as)-273.2(pl)18.1(a)13.3(c)0(e)20.4(b)0(o)21.3(-)0(c)18.1(o)0(n)20.5(t)0(r)21.5(o)0(l)21.9(l)0(e)15.5(d)-279.7(h)11.8(u)0(m)19.1(a)0(n)-275.2(c)0(l)21.5(i)0(n)19.2(i)0(c)19.6(a)13.3(l)-281.1(t)0(r)21.5(i)0(a)16.7(l)0(s)]TJ T* (\()Tj 0 0 0 0.7 k 0.3342 0 TD (3)Tj 0 0 0 1 k 0.4655 0 TD (,)Tj 0 0 0 0.7 k 0.4297 0 TD (4)Tj 0 0 0 1 k 0.4714 0 TD [(\),)-202.9(s)11.9(u)12.7(gg)14.9(es)22.1(ti)18.9(ng)-200.5(th)21.4(e)-210.6(p)0(o)17.4(t)15.6(en)20.1(ti)18.9(al)-202.2(ap)20.1(pl)18.1(ic)19.6(a)13.3(t)0(i)18.9(o)0(n)-200.3(o)0(f)-199.6(h)11.8(el)15.5(m)12.3(i)0(n)19.2(t)0(h)-199.4(i)0(n)19.2(f)0(e)20.7(c)0(t)19.8(i)0(o)20(n)-210.9(or)]TJ -1.7008 -1.2114 TD [(h)11.8(e)0(l)21.5(m)0(i)15.7(n)0(t)19.5(h)11.8(-)13.8(d)0(e)17(r)11.9(iv)19.8(ed)-221.7(pr)18.7(od)17.4(u)12.7(c)0(t)19.8(s)-232.8(in)-225.4(IB)20.8(D)-231.8(t)0(h)21.4(e)0(r)22.1(a)0(p)20.1(y)0(.)-225.1(M)0(e)17.9(c)0(h)22(a)0(n)17.2(i)15.3(st)15.5(ic)-219.1(st)21.5(ud)19.5(ie)19.6(s)-232.8(t)0(o)]TJ T* [(da)20.1(te)-171.2(h)11.8(a)0(v)17.8(e)-180.8(m)12.3(a)0(i)22.7(n)0(l)15.2(y)-180.5(fo)21.2(cu)22.9(se)16.1(d)-178.2(o)0(n)-170.4(t)0(h)21.4(e)-180.8(r)11.9(o)0(l)16(e)0(s)-168.9(o)0(f)-169.8(t)0(y)20(p)12.7(e)-180.8(2)-183.4(im)21.7(m)12.3(u)0(n)16.7(i)0(t)18.9(y)-180.5(m)12.3(e)0(d)22.9(i)0(a)16.7(t)0(e)19.8(d)]TJ T* [(by)-259.4(Th)23.1(2)-267(a)0(n)17.2(d)-267.7(r)11.9(e)0(g)20.6(u)0(l)18.1(a)0(t)22.9(o)0(r)16.6(y)-264.1(T)-269.2(c)0(e)20.4(l)0(l)16.6(s)-268.6(\()]TJ 0 0 0 0.7 k 12.2158 0 TD (4)Tj /F13 1 Tf 0 0 0 1 k 0.4714 0 TD ()Tj /F11 1 Tf 0 0 0 0.7 k 0.5013 0 TD (6)Tj 0 0 0 1 k 0.4655 0 TD [(\).)-262.5(H)14(o)0(w)19.3(e)0(v)20.6(e)0(r)22.1(,)-271.3(s)11.9(o)0(m)17(e)-264.3(re)16.1(p)12.8(o)0(r)16.6(t)15.6(s)-268.6(h)0(a)19.1(v)0(e)]TJ -13.654 -1.2055 TD [(i)-8.5(m)0(p)-16.7(l)-6.6(i)-8.5(c)-7.7(a)-10.6(t)-8.3(e)-7.7(d)-464.7(t)-8.3(h)-12.1(at)-472.4(t)-8.3(h)0(e)-473.3(m)0(a)-16.1(c)-7.7(r)-12(o)-7.3(ph)-17.2(ag)-12.1(e)-467.2(p)-11.1(o)-7.2(p)-11.1(ul)-11.8(a)-10.6(t)-8.3(i)-8.5(o)-7.3(n)-8(s)-465.5(a)-10.6(r)0(e)-473.2(i)-8.5(n)-8(v)-7.5(o)-7.3(l)-6.6(v)-13.4(e)-7.7(d)-464.7(i)-8.5(n)]TJ 0 -1.2114 TD [(h)11.8(e)0(l)21.5(m)0(i)15.7(n)0(t)19.5(h)11.8(-)13.8(g)0(e)20.6(n)0(e)14.1(r)11.9(a)13.3(t)0(e)19.8(d)-231.9(pr)18.7(ot)20.2(ec)20.4(ti)18.9(on)-218.2(a)13.3(g)0(a)17.8(i)0(n)19.2(s)11.9(t)-229.1(i)0(n)19.2(t)0(e)19.8(s)11.9(ti)18.9(na)17.2(l)-227.4(p)12.7(at)16.9(h)11.8(o)0(l)21.9(o)0(g)21.1(y)-234.2(\()]TJ 0 0 0 0.7 k 23.3992 0 TD (7)Tj /F13 1 Tf 0 0 0 1 k 0.4714 0 TD ()Tj /F11 1 Tf 0 0 0 0.7 k 0.5013 0 TD (9)Tj 0 0 0 1 k 0.4655 0 TD (\).)Tj -23.5722 -1.2114 TD [(M)13.7(a)0(c)17.5(r)11.9(op)17.4(h)11.8(a)0(g)17.8(e)0(s)-180.8(a)0(r)19.2(e)-192.7(a)-195.6(v)0(e)20.6(r)11.9(s)11.9(a)0(t)16.9(i)0(l)20.7(e)-192.7(ce)20.4(ll)-186.3(p)12.7(o)0(p)17.4(u)12.8(la)18.6(ti)24.9(on)-188.3(t)15.6(h)0(a)19.1(t)-193.3(pl)18.1(a)13.3(y)0(s)-186.5(v)0(i)19.8(t)0(a)22.9(l)-191.6(ro)16.6(le)21.5(s)]TJ -1.2651 -1.2114 TD [(in)-320.9(cl)21.5(ea)17.5(r)11.9(i)0(n)19.2(g)-329.7(ba)23.9(ct)19.8(er)22.1(ia)-323.5(fr)22.4(om)-317.2(lo)16(ca)23.5(l)-328.9(t)0(i)18.9(s)11.9(su)18.7(es)22.1(,)-331(t)0(r)21.5(a)0(n)17.2(s)11.9(la)18.6(ti)18.9(ng)-319.9(a)13.3(l)0(e)21.5(r)0(t)-318.7(s)0(i)15.3(g)0(n)20.3(a)13.3(ls)-317(to)]TJ T* 0.0314 Tc [(other)-475.9(i)-1(mmune)-477.6(cells,)-478.7(s)1.5(ecretin)5.5(g)-483.3(c)-0.2(yt)5.2(oki)5(n)-0.5(es)-481.8(to)-477.1(establish)-481.9(l)0.9(ocal)]TJ T* 0 Tc [(h)11.8(o)0(m)17(e)0(o)20.8(s)11.9(ta)22.9(ti)18.9(c)-425.4(i)0(m)21.7(m)12.3(un)16.7(e)-419.5(c)0(e)20.4(l)0(l)-413.1(n)0(e)20.1(t)0(w)18.2(o)0(r)22.6(k)11.6(s,)-414.6(an)17.2(d)-422.9(p)12.8(ar)19.2(ti)18.9(ci)19.6(p)12.8(a)0(t)16.9(i)15.3(ng)-415.3(in)-410.4(T)-424.4(c)0(e)20.4(l)0(l)]TJ T* [(re)16.1(st)15.5(im)15.7(ul)12.1(at)16.9(io)14(n)-431.7(a)0(n)17.2(d)-434.8(ma)13.7(in)13.3(te)19.8(na)11.2(nc)14.1(e)-431.4(w)0(i)12(t)0(h)21.4(i)0(n)-428.3(t)0(h)15.4(e)-437.4(la)18.6(mi)15.7(na)-430.4(pr)18.7(op)11.5(ia)-424.9(\()]TJ 0 0 0 0.7 k 24.163 0 TD (10)Tj 0 0 0 1 k 0.9429 0 TD (\).)Tj -25.1059 -1.2055 TD [(A)12.7(c)0(t)19.8(i)0(v)19.8(a)0(t)16.9(e)0(d)-418.7(m)12.3(a)13.3(c)0(r)16.1(o)0(p)23.4(h)0(a)19.1(g)0(e)20.6(s)-429.7(a)13.3(r)0(e)-419.5(f)0(u)17.3(n)0(c)20.1(t)0(i)18.9(o)0(n)20.5(a)13.3(ll)22.6(y)-431.2(d)12.7(iv)19.8(id)16.1(ed)-412.7(in)19.2(to)-421.4(t)15.6(w)0(o)-416.4(m)0(a)19.7(i)0(n)]TJ 0 -1.2114 TD [(ca)17.5(t)15.6(e)0(g)14.7(o)0(r)22.6(i)0(e)19.6(s)11.9(:)-134.1(t)0(h)21.4(e)-127.1(M1)-122(ty)20(pe)-120.3(\(t)18.4(h)11.8(e)-133(cl)21.5(as)19.2(s)11.9(i)0(c)19.6(a)0(l)18.6(-)13.8(ac)17.5(ti)18.9(va)23.7(te)19.8(d)-130.5(m)0(a)19.7(c)0(r)16.1(o)0(p)23.4(h)11.8(ag)17.8(e\))-118.2(an)17.2(d)-130.5(t)0(h)21.4(e)]TJ T* [(M2)-301(ty)20(p)12.7(e)-312.1(\(t)18.4(h)11.8(e)-312.1(al)18.6(te)19.8(r)11.9(n)0(a)17.2(t)0(i)24.9(v)0(e)14.7(l)0(y)-300.5(a)13.3(ct)19.8(iv)19.8(at)22.9(ed)-305.3(m)12.3(a)0(c)17.5(r)11.9(op)17.4(h)11.8(a)13.3(ge)14.7(\))-307.5(\()]TJ 0 0 0 0.7 k 20.1528 0 TD (11)Tj 0 0 0 1 k 0.9369 0 TD [(\).)-304.3(A)12.7(l)0(t)20.9(h)11.8(ou)17.4(gh)]TJ -21.0897 -1.2114 TD [(M1-type)-447.1(macrophages)-450.1(release)-452.1(proin)]TJ /F12 1 Tf 14.8654 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ammatory)-449.2(cytokines)-449.3(and)]TJ -15.3966 -1.2114 TD [(en)20.1(h)11.8(a)0(n)17.2(c)0(e)-361.5(i)0(n)]TJ /F12 1 Tf 4.3922 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(ma)19.7(to)20.2(r)11.9(y)-377.5(r)11.9(e)0(s)22.1(p)0(o)17.4(n)0(s)21.8(e)0(s)22.1(,)-378.8(t)15.6(h)0(e)16(y)-371.5(a)13.3(l)0(s)17.2(o)-371.3(ca)17.5(u)12.8(s)0(e)-365.8(i)0(n)19.2(j)0(u)24(r)0(y)-365.6(t)0(o)-361.7(h)11.8(os)22.6(t)]TJ -4.9114 -1.2114 TD -0.0119 Tc [(t)-11.9(i)7(ssu)-11.9(e)-341(\()]TJ 0 0 0 0.7 k 2.8466 0 TD -0.0135 Tc (12)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc [(\).)-322.2(On)-325.3(th)21.4(e)-335.9(c)0(o)20.9(n)0(t)19.5(r)0(a)19.2(r)11.9(y,)-326.6(M2)21.3(-t)17.5(yp)23.2(e)-335.9(m)0(a)19.7(c)0(r)16.1(o)0(p)23.4(h)11.8(ag)17.8(es)-324(r)11.9(e)0(l)15.5(e)0(a)23.5(s)0(e)-324(a)0(n)17.2(t)0(i)18.9(-)]TJ -3.7835 -1.2055 TD 0.0264 Tc (in)Tj /F12 1 Tf 0.8534 0 TD 0 Tc ()Tj /F11 1 Tf 0.555 0 TD 0.0262 Tc [(ammatory)-476.6(cytokines)-475.1(a)-2.3(nd)-474.3(help)-480.2(maintain)-477.1(tissue)-476.8(immune)]TJ -1.4084 -1.2114 TD 0 Tc [(h)11.8(o)0(m)17(e)0(o)20.8(s)11.9(ta)22.9(si)15.3(s)11.9(,)-360.9(th)15.4(u)12.7(s)-364.1(av)17.8(oi)20(d)12.7(i)0(n)19.2(g)-365.5(ov)21.1(er)22.1(ac)17.5(t)15.6(i)0(v)19.8(e)-365.8(in)]TJ /F12 1 Tf 16.1783 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(m)12.3(a)0(t)16.9(i)0(o)20(n)-360.1(\()]TJ 0 0 0 0.7 k 4.7264 0 TD (13)Tj 0 0 0 1 k 0.9369 0 TD (,)Tj 0 0 0 0.7 k 0.5848 0 TD -0.0135 Tc (14)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc [(\).)-352.1(In)]TJ -23.8826 -1.2114 TD [(th)21.4(e)]TJ /F12 1 Tf 1.5576 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(gh)22.2(t)-330.6(a)0(g)17.7(a)13.3(in)19.2(s)11.9(t)-330.6(fo)21.2(r)11.9(e)0(i)19.6(g)0(n)-319.9(p)0(a)20.1(t)0(h)21.4(o)0(g)21.1(e)0(n)20.1(s)0(,)-319.1(t)0(h)15.4(e)-324(sh)17.8(if)19.9(ti)18.9(ng)-313.9(ba)18(la)18.6(nc)20.1(e)-330(b)0(e)20.8(t)15.6(we)18.8(en)]TJ -2.0767 -1.2114 TD [(pr)18.7(oi)20(n)]TJ /F12 1 Tf 2.1364 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(m)12.3(a)0(t)16.9(o)0(r)22.6(y)-335.7(M1)-330.8(a)13.3(n)0(d)-329.5(w)0(o)19.3(u)12.7(nd)16.7(-)13.8(h)11.8(ea)17.5(li)20.7(ng)-325.8(M2)-330.8(m)12.3(a)0(c)17.5(r)11.9(op)23.4(ha)19.1(ge)20.6(s)-340.2(o)0(v)21.1(e)0(r)]TJ -2.6556 -1.2114 TD [(ti)18.9(m)12.3(e)-389.6(is)-384.5(es)22.1(se)16.1(nt)19.5(ia)22.7(l)-388.5(f)0(o)15.2(r)-387.9(pr)18.7(op)17.4(er)-377.7(re)16.1(s)11.9(o)0(l)21.9(u)0(t)16.4(i)15.3(on)-385.3(of)-378.7(in)]TJ /F12 1 Tf 17.6404 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(ma)19.7(ti)18.9(on)-379.3(\()]TJ 0 0 0 0.7 k 4.7562 0 TD (15)Tj 0 0 0 1 k 0.9369 0 TD [(\).)-381.9(In)]TJ -23.8527 -1.2114 TD [(ad)20.1(di)22.1(ti)18.9(on)20.5(,)-331(M)0(2)21.3(-)0(t)17.5(y)0(p)23.2(e)-330(m)12.3(a)0(c)17.5(r)11.9(op)17.4(h)11.8(a)0(g)17.7(e)0(s)-318.1(h)11.8(av)17.8(e)-330(b)0(e)20.8(e)0(n)-320.1(r)11.9(ep)17(or)22.6(te)19.8(d)-327.4(t)0(o)-319.9(a)0(t)22.9(t)0(e)19.8(n)0(u)16.7(a)13.3(te)]TJ T* [(experi)9.2(mentally)-436.9(induced)-441.3(in)]TJ /F12 1 Tf 10.7716 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ammati)10.5(on)-445(in)-446.2(the)-445.8(gut)-444.7(\()]TJ 0 0 0 0.7 k 9.5423 0 TD (16)Tj 0 0 0 1 k 0.9548 0 TD [(\).)-447.5(Passiv)10.2(e)]TJ -21.7998 -1.2055 TD [(tr)21.5(an)17.2(s)11.9(f)0(e)20.7(r)-429.7(of)]TJ /F14 1 Tf 4.6428 0 TD [(in)-422.4(v)13.3(i)0(t)17(r)11.9(o)]TJ /F11 1 Tf 3.4493 0 TD [(de)17(r)11.9(i)0(v)19.8(e)0(d)-418.7(a)13.3(lt)20.9(er)16.1(na)23.2(ti)18.9(ve)20.6(ly)-419.9(a)13.3(c)0(t)19.8(i)0(v)19.8(a)13.3(te)19.8(d)-428.9(m)0(a)19.7(c)0(r)16.1(o)0(p)23.4(h)11.8(ag)17.8(es)]TJ -8.0921 -1.2114 TD 0.0259 Tc [(conferred)-474.6(s)2(igni)]TJ /F12 1 Tf 6.5465 0 TD 0 Tc ()Tj /F11 1 Tf 0.555 0 TD 0.0259 Tc [(cantly)-476.9(reduced)-474.6(coloni)5.4(c)-477.1(i)-0.5(n)]TJ /F12 1 Tf 11.255 0 TD 0 Tc ()Tj /F11 1 Tf 0.555 0 TD 0.0267 Tc [(amma)4.2(tion)-470.7(\()]TJ 0 0 0 0.7 k 5.1501 0 TD 0.0283 Tc (16)Tj 0 0 0 1 k 1.0085 0 TD 0.027 Tc (\).)Tj -25.0701 -1.2114 TD 0.0352 Tc [(He)3.6(l)4.7(m)-0.2(in)3.3(th-m)5.8(od)6.2(ul)4.7(ate)3.6(d)-483.2(ma)6.7(cr)5.3(op)6.2(ha)6.7(ge)3.6(s)-484(h)5.2(av)3.9(e)-479.8(b)4.1(ee)3.6(n)-480.1(e)3.6(xpl)4.7(o)-1.9(r)5.3(e)-2.3(d)-477.2(a)0.8(s)]TJ T* 0 Tc [(pr)18.7(om)23(is)21.3(in)19.2(g)-234.2(t)15.6(he)16(r)11.9(a)0(p)20.1(e)0(u)17(t)0(i)24.9(c)-234.5(fo)21.2(r)-226.8(i)0(n)]TJ /F12 1 Tf 10.9865 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(ma)19.7(to)20.2(ry)-222.3(d)12.7(i)0(s)15.3(e)0(a)23.5(s)11.9(e)-234.5(\()]TJ 0 0 0 0.7 k 7.567 0 TD (8)Tj 0 0 0 1 k 0.4655 0 TD (,)Tj 0 0 0 0.7 k 0.4476 0 TD (16)Tj /F13 1 Tf 0 0 0 1 k 0.9369 0 TD ()Tj /F11 1 Tf 0 0 0 0.7 k 0.5013 0 TD (18)Tj 0 0 0 1 k 0.9369 0 TD (\).)Tj -21.0957 -1.2114 TD [(Th)23.1(e)-204.6(p)0(r)18.7(o)0(g)21.1(r)0(a)19.2(m)0(m)18.7(e)0(d)-197.9(c)0(e)20.4(l)0(l)-192.3(d)0(e)17(a)0(t)22.9(h)0(-)19.7(1)-207.3(\(P)21.8(D-)20.8(1\))-198.5(is)-199.5(a)-201.5(m)0(e)16.6(m)12.3(be)20.8(r)-208.9(o)0(f)-193.7(t)0(h)21.4(e)-210.6(CD)24.4(28)]TJ -1.2651 -1.2114 TD [(s)11.9(u)0(p)19.5(e)0(r)16.1(f)0(a)23.8(m)0(i)15.7(l)0(y)-211(t)0(h)21.4(a)0(t)-215.8(d)12.7(el)21.5(iv)19.8(er)16.1(s)-220.8(n)0(e)20.1(g)0(a)17.7(t)15.6(iv)19.8(e)-222.5(s)0(i)15.3(g)0(n)20.3(a)13.3(ls)-215.5(u)12.7(p)0(o)17.4(n)-222.9(in)19.2(te)19.8(r)11.9(a)0(c)17.5(t)0(i)24.9(o)0(n)-218.2(w)14.6(it)18.9(h)-220.9(i)0(t)18.9(s)]TJ 9.5 0 0 9.5 306.1417 615.6282 Tm [(tw)24.2(o)-281.8(l)0(i)20.6(g)0(a)17.7(n)0(d)22.6(s)11.9(,)-283.3(P)13(D-)20.8(L1)-273(a)13.3(n)0(d)-269.8(P)0(D)19.9(-)0(L)19.7(2)0(.)-269.8(E)0(x)21.5(p)0(r)18.7(e)0(s)16.1(s)11.9(io)20(n)-276.6(o)0(f)-271.2(P)0(D)19.9(-)0(1)-271(o)0(n)-265.9(T)-281.2(ce)20.4(ll)22.6(s,)-271.4(B)]TJ T* [(ce)20.4(ll)22.6(s,)-193.8(m)12.3(a)0(c)17.5(r)11.9(op)17.4(h)11.8(a)13.3(ge)14.7(s)11.9(,)-199.7(an)17.2(d)-202.1(d)12.7(en)20.1(dr)18.7(it)18.9(ic)-189.3(ce)20.4(ll)22.6(s)-202.9(\()0(D)21.7(C)0(s)17.4(\))-200.1(is)-187.6(in)19.2(du)19.5(ci)19.6(bl)21.9(e)-204.6(\()]TJ 0 0 0 0.7 k 22.4324 0 TD -0.0135 Tc (19)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc [(\))14.8(.)-205.7(Th)23.1(e)]TJ -23.3693 -1.2114 TD [(PD)-10(-)-10(1)-463.9(pa)-9.8(t)-8.3(h)0(w)-9.4(a)-10.6(y)-461(i)-8.5(s)-459.5(v)-7.5(i)-8.5(t)-8.3(al)-464.8(f)-7.4(o)-7.3(r)-465.5(p)0(h)-11.2(y)-7.5(si)-14.5(ol)-7.9(o)-7.2(g)-7.5(i)-8.5(c)-461.2(re)-13.7(g)-7.5(u)0(l)-11.8(a)0(t)-12.9(i)-8.5(o)-7.2(n)-461.6(o)-7.3(f)-460.9(i)-8.5(m)0(m)-11.1(u)0(n)-13.2(e)]TJ 0 -1.2055 TD [(r)11.9(e)0(s)16.1(p)12.8(on)20.5(se)16.1(s)-292.4(t)0(o)-284.1(a)13.3(vo)15.1(i)15.3(d)-297.6(in)19.2(ju)24(ri)15.3(ou)23.4(s)-298.4(o)0(v)21.1(e)0(r)22.1(a)0(c)17.5(t)0(i)24.9(v)0(e)-289.7(i)15.3(n)]TJ /F12 1 Tf 16.3812 0 TD ()Tj /F11 1 Tf 0.5252 0 TD -0.0133 Tc [(am)-13.3(m)5.4(a)-13.3(t)9.6(i)-13.3(o)6.7(n)-307.8(\()]TJ 0 0 0 0.7 k 4.6548 0 TD 0 Tc (20)Tj 0 0 0 1 k 0.9369 0 TD (,)Tj 0 0 0 0.7 k 0.5132 0 TD (21)Tj 0 0 0 1 k 0.9369 0 TD [(\).)-286.4(In)]TJ -23.9482 -1.2114 TD [(a)13.3(d)0(d)19.5(i)0(t)18.9(i)0(o)20(n)0(,)-195.8(P)13(D-)20.8(1)-201.3(s)0(e)16.1(r)11.9(ve)20.6(s)-202.9(a)0(s)-195.6(a)13.3(n)-205(i)0(m)21.7(p)0(o)17.4(r)11.9(ta)16.9(nt)-189.4(im)21.7(mu)19.1(ne)-194.8(ch)22(ec)14.4(k)11.6(p)12.7(oi)20(nt)-195.4(to)-188.6(ke)15.8(ep)]TJ T* [(im)21.7(mu)19.1(ne)-391.7(ba)23.9(la)18.6(nc)20.1(e)-401.6(a)13.3(nd)-395.1(p)12.8(r)11.9(ev)20.6(en)14.1(t)-396.2(a)0(u)20.1(t)0(o)20.2(i)0(m)21.7(m)0(u)19.1(n)0(i)19.2(t)0(y)-391.8(\()]TJ 0 0 0 0.7 k 18.6251 0 TD (21)Tj /F13 1 Tf 0 0 0 1 k 0.9369 0 TD ()Tj /F11 1 Tf 0 0 0 0.7 k 0.5013 0 TD (23)Tj 0 0 0 1 k 0.9369 0 TD [(\).)-393.8(A)12.7(l)0(t)20.9(h)11.8(ou)17.4(gh)]TJ -21.0002 -1.2114 TD [(m)12.3(a)0(n)17.2(y)-276(s)11.9(t)0(u)16.4(d)12.8(ie)19.6(s)-280.5(h)11.8(a)13.3(v)0(e)-271.8(s)11.9(h)11.8(o)0(w)19.3(n)-276.6(th)21.4(e)-276.2(i)0(m)15.7(p)12.8(or)22.6(ta)16.9(nc)20.1(e)-276.2(o)0(f)-265.3(P)0(D)19.9(-)0(1)-265(i)0(n)-267.2(m)0(o)17(d)12.8(ul)18.1(a)13.3(t)0(i)18.9(n)0(g)]TJ T* [(th)21.4(e)-258.3(T)-263.2(ce)20.4(ll)-246(fu)17.3(nc)20.1(ti)18.9(on)20.5(,)-259.4(s)11.9(om)17(e)-258.3(e)0(v)20.6(i)0(d)22.1(e)0(n)20.1(c)0(e)-254.1(h)11.8(as)-249.3(em)16.6(er)22.1(ge)20.6(d)-261.8(t)0(h)21.4(a)0(t)-251.6(P)13(D-)20.8(1)-261(p)12.8(la)18.6(ys)-252.2(a)]TJ T* [(d)12.7(i)0(s)15.3(t)15.6(in)19.2(ct)-218.9(ro)16.6(le)-217.2(in)-219.5(t)15.5(h)0(e)-222.7(r)11.9(eg)20.6(ul)18.1(a)13.3(t)0(i)18.9(o)0(n)-218.2(o)0(f)-217.5(m)0(a)19.7(c)0(r)16.1(o)0(p)23.4(h)11.8(ag)17.8(e)-228.5(p)12.7(ol)16(a)13.3(r)11.9(iz)19.6(at)16.9(io)20(n)-228.8(\()]TJ 0 0 0 0.7 k 22.7905 0 TD -0.0135 Tc (24)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc (,)Tj 0 0 0 0.7 k 0.4416 0 TD (25)Tj 0 0 0 1 k 0.9429 0 TD -0.0148 Tc (\).)Tj -25.1119 -1.2114 TD 0.0241 Tc [(Expression)-473.3(of)-472.6(PD-1)-475.6(was)-477.2(r)0.2(eported)-476.4(t)3.8(o)-472.5(p)-4.9(ro)4.9(mote)-473(macrophage)]TJ 0 -1.2055 TD 0.0442 Tc [(polarization)-494.9(toward)-492.1(M2)-491.3(phenoty)-5.1(p)3.2(e)-494.6(a)-2.2(nd)-492.1(PD-1)-497.3(de)]TJ /F12 1 Tf 22.3548 0 TD 0 Tc ()Tj /F11 1 Tf 0.5789 0 TD 0.0437 Tc (ciency)Tj -22.9337 -1.2114 TD 0 Tc [(en)20.1(h)11.8(a)0(n)17.2(c)0(e)20.4(d)-231.9(M)13.7(1)-231.2(p)12.7(o)0(l)16(a)13.3(ri)21.3(za)17.5(ti)18.9(on)-218.2(\()]TJ 0 0 0 0.7 k 10.8015 0 TD -0.0135 Tc (26)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc (,)Tj 0 0 0 0.7 k 0.4476 0 TD -0.0135 Tc (27)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc (\).)Tj -11.8577 -1.2114 TD [(In)-337.4(recent)-337.9(years,)-344.9(many)-336(studies)-345.3(have)-336.2(indicated)-344.2(that)-337.7(helminths)]TJ -1.2651 -1.2114 TD [(induce)-346.6(PD-1)-346.6(pathway)-343.9(to)-349.8(modulate)-342.8(the)-350.3(host)-344(immune)-344.9(system)-351.4(to)]TJ T* 0.0188 Tc [(mi)4.3(ni)4.3(mize)-514.1(exce)5.1(ssiv)5.4(e)-520(i)4.3(n)]TJ /F12 1 Tf 9.5244 0 TD 0 Tc ()Tj /F11 1 Tf 0.5431 0 TD 0.0167 Tc [(a)-5.8(mmation)-522.4(against)-516.8(i)2.2(nvad)-6.4(ed)-519.6(parasites)]TJ -10.0674 -1.2114 TD 0 Tc [(facilitat)-10.9(ing)-501.5(worms)]TJ /F13 1 Tf 7.4476 0 TD ()Tj /F11 1 Tf 0.7221 0 TD [(survival)-505.4(and)-507.1(promoting)-505.2(the)-505.5(chronic)-9.5(ity)-501.8(of)]TJ -8.1697 -1.2055 TD [(helminth)-492.6(infection)-495.2(\()]TJ 0 0 0 0.7 k 8.5039 0 TD (28)Tj 0 0 0 1 k 0.9548 0 TD (\).)Tj /F14 1 Tf 1.0563 0 TD [(Trichinella)-493.2(spiralis)]TJ /F11 1 Tf 7.5491 0 TD [(,)-492.2(a)-493.9(tissue-dwelling)]TJ -18.0641 -1.2114 TD [(intestinal)-212(nematode,)-212.3(is)-205.5(known)-212(to)-206.5(secrete)-212.3(molecules)-209.5(that)-212.3(modulate)]TJ T* [(the)-320.5(host)-326(immune)-327(system)-321.6(\()]TJ 0 0 0 0.7 k 10.6642 0 TD (29)Tj 0 0 0 1 k 0.9608 0 TD [(\).)-322.2(Infection)-326.7(with)-318.7(this)-327.3(nematode,)-325.7(or)]TJ -11.625 -1.2114 TD [(treatment)-225.7(with)]TJ /F14 1 Tf 6.1168 0 TD (Trichinella)Tj /F11 1 Tf 4.2788 0 TD [(-derived)-230.8(proteins,)-226.9(has)-231.5(been)-221.7(extensively)]TJ -10.3957 -1.2114 TD [(investigated)-237.1(for)-229.5(the)-236.9(treatment)-231.7(of)-235.4(many)-234.6(hypersensitivity)-236.7(disorders)]TJ T* (\()Tj 0 0 0 0.7 k 0.3461 0 TD (7)Tj 0 0 0 1 k 0.4774 0 TD (,)Tj 0 0 0 0.7 k 0.6684 0 TD (30)Tj 0 0 0 1 k 0.9608 0 TD (,)Tj 0 0 0 0.7 k 0.6684 0 TD (31)Tj 0 0 0 1 k 0.9608 0 TD [(\).)-453.5(Our)-453.8(previous)-459.1(study)-455.8(demonstrated)-455.8(that)-451(excretory/)]TJ -4.0819 -1.2055 TD 0.0191 Tc [(secretory)-519.5(p)-4(roduct)4.8(s)-524(f)-0.2(rom)]TJ /F14 1 Tf 11.0342 0 TD 0.0214 Tc [(T.)-513.5(spi)5(r)3.5(alis)]TJ /F11 1 Tf 4.8278 0 TD 0.0213 Tc [(ad)4.2(ult)-518.1(w)6(orms)-515.8(\()]TJ /F14 1 Tf 6.3436 0 TD 0.0157 Tc (Ts)Tj /F11 1 Tf 0.9608 0 TD 0.0212 Tc [(-AES)5.8(\))]TJ -23.1664 -1.2114 TD 0.049 Tc [(ameliorated)-547(D)2.2(SS-in)5.2(d)-3.9(uced)-546.9(coli)4.7(tis)-547.8(i)4.6(n)-549.8(m)1.7(ice)]TJ /F14 1 Tf 19.4188 0 TD 0.0523 Tc [(vi)6(a)]TJ /F11 1 Tf 1.8918 0 TD 0.0495 Tc [(inhi)5.1(biti)5.1(ng)]TJ -21.3105 -1.2114 TD 0 Tc (proin)Tj /F12 1 Tf 2.1842 0 TD ()Tj /F11 1 Tf 0.5371 0 TD [(ammatory)-312(cytokines)-312(\(IFN-)]TJ /F8 1 Tf 10.7836 0 TD (g)Tj /F11 1 Tf 0.4058 0 TD [(,)-313.1(IL-6,)-310.9(IL-17\))-315.7(\()]TJ 0 0 0 0.7 k 5.9319 0 TD (5)Tj 0 0 0 1 k 0.4834 0 TD [(\).)-310.3(It)-307.9(has)-315.1(been)]TJ -20.3258 -1.2114 TD [(reported)-387.5(that)-385.4(adoptive)-382.4(transfer)-388.2(of)-384.6(macrophages)-390.4(obtained)-385.1(from)]TJ T* 0.0198 Tc [(helminth-inf)-5.5(ected)-522.4(mice)-525(an)-6.1(d)-516.5(h)-4.2(elminth)-517.4(E)-3(S)-520.7(p)2.7(rotein-ac)-5.8(t)-0.5(ivate)-5.8(d)]TJ T* 0 Tc [(macrophages)-408.3(reduced)-402.6(allergic)-407.4(asthma)-405.2(and)-405.7(DSS-induced)-409.6(colitis)]TJ T* [(in)-398.5(mice)-405.5(\()]TJ 0 0 0 0.7 k 3.8551 0 TD (16)Tj 0 0 0 1 k 0.9548 0 TD [(\).)-399.8(However,)-404.2(the)-404(signal)-405.3(pathway\(s\))-403.9(and)-399.7(mechanism)]TJ -4.8099 -1.2055 TD [(inv)-12.1(olv)-9.4(ed)-508.2(in)-511.9(th)-8.4(e)-503(M)0(2)-509.9(m)0(a)-10.2(c)0(r)-7.7(opha)-11.2(ge)-510.5(pol)-13.1(ariz)-14.9(at)-7(ion)-513.2(ind)-9.8(uce)-8.6(d)-506.4(b)-7.3(y)]TJ /F14 1 Tf 24.8314 0 TD (T.)Tj -24.8314 -1.2114 TD (spiralis)Tj /F11 1 Tf 3.1867 0 TD [(AES)-407.5(are)-406.2(still)-406.1(unknown.)-413(Here,)-410(we)-404.9(characterize)-410.9(the)-404(role)]TJ -3.1867 -1.2114 TD (of)Tj /F14 1 Tf 1.0622 0 TD [(T.)-270.1(spiralis)]TJ /F11 1 Tf 4.1416 0 TD [(AES)-270.2(in)-267.2(the)-272.8(M2)-271.1(macrophage)-271(polarization)-273.6(associated)]TJ -5.2038 -1.2114 TD [(with)-294.8(the)-302.6(therapeutic)-302.1(ef)]TJ /F12 1 Tf 9.047 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(cacy)-296(of)-301.1(DSS-induced)-302.1(colitis)-297.7(in)-303(mice)-298.1(and)]TJ -9.5781 -1.2114 TD [(the)-326.5(involvement)-327.4(of)-330.9(PD-1)-322.8(in)-326.9(the)-326.5(activation)-330(of)-330.9(M2)-324.9(macrophages.)]TJ T* [(This)-224.2(study)-229(highlights)-226.4(the)-225(importance)-230(of)-223.5(PD-1)-227.3(as)-225.4(a)-225.4(checkpoint)-228(for)]TJ 0 -1.2055 TD [(AES-induced)-387.4(M2)-384.5(macrophage)-390.4(polarization)-387(associated)-388.2(with)-384.3(the)]TJ 0 -1.2114 TD [(protective)-390.5(ef)62.5(fects)-389.2(of)-384.6(AES)-383.6(on)-385.3(DSS-induced)-391.7(colitis.)-390(Our)]TJ /F12 1 Tf 22.4444 0 TD ()Tj /F11 1 Tf 0.5311 0 TD (ndings)Tj -22.9755 -1.2114 TD 0.0436 Tc [(provide)-543(n)-0.2(ew)-538.6(insi)5.2(ghts)-541.3(int)5.4(o)-542.5(the)-537(m)-3.7(ec)6.1(hani)5.2(sms)-541.3(o)0.5(f)-536.7(h)-4.3(e)6.1(l)1.2(mi)5.2(nth)]TJ T* 0.03 Tc [(immu)-5(nom)-5.4(o)-1.1(dulation)-533(o)-1.1(f)-532.4(t)3.8(he)-532.7(hos)-5.8(t)-527.3(immu)-5(ne)-526.7(s)-5.8(y)-1.3(stem)-536.5(and)-530.1(t)-2.2(he)]TJ T* 0 Tc [(pot)-8.8(e)-7.7(ntia)-11.6(l)-507.9(t)0(h)-8.4(e)0(r)-7.7(a)0(p)-9.8(eut)-9.2(ic)-511.6(e)-7.7(f)58.3(fec)-10.9(t)-503.6(o)-7.2(f)-508.7(nem)-9.4(at)-7(ode)-14.1(-de)-11(ri)-8.6(ved)-515.7(pro)-12.4(tein)-14.7(s)-507.3(o)0(n)]TJ T* (in)Tj /F12 1 Tf 0.7997 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ammatory)-306(bowel)-300.7(diseases.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 306.1417 122.0598 Tm [(MATERIALS)-301.3(AND)-301.7(METHODS)]TJ 0 -1.748 TD (Animals)Tj /F11 1 Tf 9.5 0 0 9.5 306.1417 89.5748 Tm [(Wild-type)-451.6(\(WT\))-447.3(and)-447.5(PD-1)-442.1(knockout)-450.2(mice)-447.3(\(KO)-448.1(mice\))-444.4(of)-450.3(the)]TJ 0 -1.2114 TD [(C57BL/6)-290.3(strain)-298.1(were)-293.3(purchased)-292.3(from)-294.7(Jackson)-296.8(Laboratory)-291.6(\(stock)]TJ T* [(no.)-388.1(021157,)-387.2(USA\).)-389.7(Female)-389.5(ICR)-384.2(mice)-387.6(aged)-389(6)]TJ /F13 1 Tf 18.1775 0 TD ()Tj /F11 1 Tf 0.5132 0 TD [(8)-386.3(weeks)-389.1(and)-387.8(rats)]TJ ET q 45.354 114.066 m 289.134 114.066 l 289.134 66.557 l 45.354 66.557 l W n 0 0 0 rg 45.354 114.066 m 117.354 114.066 l 117.354 113.613 l 45.354 113.613 l 45.128 113.726 l 45.128 113.953 l f* Q BT /F15 1 Tf 7.4999 0 0 7.4999 45.3543 104.5417 Tm (Abbreviations:)Tj /F11 1 Tf 6.5613 0 TD [(IBD,)-435(in)]TJ /F12 1 Tf 3.0993 0 TD ()Tj /F11 1 Tf 0.5291 0 TD [(ammatory)-436.1(bowel)-438.7(disease;)-436.8(CloA,)-432.9(liposomal)-438.3(clodronate,)]TJ -10.1897 -1.2624 TD [(Clophosome)-249.9(-A;)-252.8(PD-1,)-250.8(programmed)-254.6(death)-250.7(1;)-247.9(WT,)-248.5(wild)-250.8(type;)-247.9(KO,)-251.7(knockout;)-258.1(DAI,)]TJ 0 -1.2699 TD [(disease)-269.3(activity)-274.3(index;)-268(MPO,)-271.9(myeloperoxidase;)-277.2(DSS,)-271.3(dextran)-270.4(sulfate)-269.8(sodium;)-275.6(AES,)]TJ T* [(excretory/secretory)-333.7(products)-326.4(from)]TJ /F14 1 Tf 14.0827 0 TD [(Trichinella)-328.5(spiralis)]TJ /F11 1 Tf 7.7103 0 TD [(adult)-329.4(worms;)-323(FVD,)]TJ /F12 1 Tf 8.111 0 TD ()Tj /F11 1 Tf 0.5291 0 TD (xable)Tj -30.4331 -1.2624 TD [(viability)-299.7(dye.)]TJ ET 0 0 0 0.7 k 45.354 737.518 504.567 0.28345 re f BT /F6 1 Tf 6.9999 0 0 6.9999 45.3543 744.2644 Tm [(Wang)-303.4(et)-300.5(al.)]TJ /F4 1 Tf 56.9126 0 TD [(Trichinella)-298.7(spiralis)]TJ /F6 1 Tf 7.6537 0 TD [(Attenuated)-302.9(Colitis)]TJ ET 45.354 42.803 504.567 0.22675 re f 45.354 42.803 504.567 0.22675 re f BT 6.9999 0 0 6.9999 45.3543 31.2945 Tm [(Frontiers)-306.1(in)-296.3(Immunology)-503.1(|)-502.8(www.frontiersin.org)]TJ 52.8468 0 TD [(October)-304.5(2020)-505.2(|)-494.7(Volume)-307.7(11)-499.6(|)-494.7(Article)-305.6(563784)]TJ -17.0811 0 TD (2)Tj ET endstream endobj 42 0 obj<> endobj 43 0 obj<> endobj 44 0 obj<> endobj 45 0 obj<> endobj 46 0 obj<> endobj 47 0 obj<> endobj 48 0 obj<> endobj 49 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 50 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 51 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 52 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 53 0 obj<>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 54 0 obj<>stream /GS1 gs BT /F11 1 Tf 9.5 0 0 9.5 45.3543 710.4754 Tm 0 0 0 1 k 0 Tc 0 Tw [(were)-269.4(purchased)-274.4(from)-264.9(the)-272.8(Capital)-265.1(Medical)-271.3(University)-270.1(Laboratory)]TJ 0 -1.2114 TD [(Animal)-325.1(Services)-329.1(Center)-324.6(\(Beijing,)-329.2(China\).)-326.1(All)-328.8(animals)-324.5(were)-323.1(kept)]TJ T* [(in)-303(a)-297(pathogen-free)-308.3(environment.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 45.3543 664.951 Tm [(Preparation)-303.4(of)-302.4(Excretory/Secretory)-313.7(\(ES\))]TJ 0 -1.0394 TD [(Products)-304.2(From)-301.5(Adults)]TJ /F14 1 Tf 9.5 0 0 9.5 45.3543 640.9699 Tm [(T.)-323.8(spiralis)]TJ /F11 1 Tf 4.249 0 TD [(\(strain)-325.1(ISS)-324.4(533\))-326.6(was)-318.3(maintained)-331.7(in)-320.9(female)-326(ICR)-324.6(mice.)]TJ -4.249 -1.2114 TD 0.0247 Tc [(The)-520.1(m)1.2(usc)5.1(l)0.2(e)-520.1(l)0.2(arvae)-520.1(w)3.5(ere)-520.1(r)0.8(e)5.1(c)-0.9(ov)5.3(ere)5.1(d)-523.5(fro)5.5(m)-523.9(i)4.2(n)-1.2(f)5.4(ect)4.4(ed)-517.5(mic)5.1(e)-520.1(by)]TJ T* 0 Tc [(digestion)-496.7(of)-498(the)-493.6(carcasses)-503.9(in)-494(arti)]TJ /F12 1 Tf 13.8927 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(cial)-492.9(gastric)-496.2(juice)-501.2(\()]TJ 0 0 0 0.7 k 7.6565 0 TD (32)Tj 0 0 0 1 k 0.9608 0 TD [(\).)-495.3(The)]TJ -23.0411 -1.2114 TD [(recovered)-492.4(muscle)-498.3(larvae)-490.5(were)-490.2(used)-495.5(to)-487(infect)-495.3(rats)-490.4(orally)-492.1(with)]TJ T* 0.0218 Tc [(14,000)-519.7(larvae)-523(each.)-524.1(S)0.5(ix)-524.7(days)-521.3(af)]TJ 13.8808 0 TD 0.0209 Tc [(ter)-522.2(i)-5.5(nfec)-4.7(tion)-5(,)-525(e)1.3(ach)-522.3(r)-3(at)-524.5(was)]TJ -13.8808 -1.2055 TD 0.0102 Tc [(e)-3.5(u)-0.9(than)-3.8(iz)-3.5(ed,)-511.8(a)-0.4(n)-3.8(d)-514.1(the)-510.7(a)-0.4(dult)]TJ /F14 1 Tf 11.6429 0 TD 0.0112 Tc [(T.)-511.7(spiral)11.2(i)-10.9(s)]TJ /F11 1 Tf 4.7324 0 TD 0.0128 Tc [(worms)-506.4(w)3.5(ere)-508.1(c)5.1(oll)6.2(ect)4.5(ed)]TJ -16.3752 -1.2114 TD 0 Tc [(from)-342.5(intestine.)-348.5(The)-342.7(collected)-345.3(adult)-346.1(worms)-338.5(were)-347(washed)-343.2(several)]TJ T* [(times)-239(with)-235.1(sterile)-235.9(saline)-238.4(\(0.9%)-231.5(NaCl\))-236.6(and)-238.6(cultured)-236.8(in)-237.4(RPMI-1640)]TJ T* [(\()-9.1(T)-6.6(he)-13.8(r)-12(m)0(o)-520.1(F)0(i)-13.7(s)0(h)-18.1(e)-7.7(r,)-522(C)-6.4(a)0(r)-16.6(l)-6.6(sb)-13.2(a)-10.6(d)0(,)-521.2(U)0(S)-14.4(A)-11.2(\))-510.4(s)-12(up)-16.3(pl)-11.8(e)-7.7(m)0(e)-19.2(n)0(t)-10.4(e)-7.7(d)-518.4(w)0(i)-11.9(t)-8.3(h)-513.3(2)-10.3(00)-522(U)]TJ T* 0.0328 Tc [(penicillin/ml)-528.8(and)-527.3(200)]TJ /F8 1 Tf 10.2345 0 TD 0 Tc (m)Tj /F11 1 Tf 0.6027 0 TD 0.0313 Tc [(g)-537.1(s)1.4(treptomyc)-6.2(i)4.9(n)-6.6(/)1.2(ml)-536.3(\()4.3(C)-4.9(aisson)-531.7(labs,)]TJ -10.8373 -1.2114 TD 0 Tc [(Logan,)-460(USA\))-458.5(at)-454.5(3000)-453.2(worms/ml)-458.3(at)-460.5(37C,)-454.8(5%)-453.9(CO)]TJ 7.1249 0 0 6.3326 243.4393 524.3527 Tm (2)Tj 9.5 0 0 9.5 246.8409 525.94 Tm [(,)-456.3(for)-456.3(48)-456.3(h.)]TJ -21.209 -1.2055 TD 0.0254 Tc [(Cultured)-528.8(medium)-523.2(containi)4.9(ng)-525.1(AES)-527.1(p)-3.6(roducts)-523.7(w)-1.8(as)-523.7(c)-6.2(o)0.2(llected)]TJ 0 -1.2114 TD 0 Tc [(and)-405.7(concentrated)-414.8(buf)63.8(fer-exchanged)-411.3(to)-409.4(PBS)-404.1(using)-411.2(a)-404.4(centrifugal)]TJ /F12 1 Tf T* ()Tj /F11 1 Tf 0.5311 0 TD [(lter)-500.1(\(Millipore)-499.4(Amicon)-501.9(Ultra-15,)-499.7(NMWL:)-502.2(3000,)-497.7(USA\),)-503(and)]TJ -0.5311 -1.2114 TD [(buf)63.8(fer-exchanged)-506.8(to)-499(PBS)-499.6(\()]TJ 0 0 0 0.7 k 11.1416 0 TD (32)Tj 0 0 0 1 k 0.9548 0 TD [(\).)-501.2(Protein)-498.4(concentration)-503.3(in)-500(AES)]TJ -12.0964 -1.2114 TD 0.0546 Tc [(was)-554.1(d)-4.3(etermined)-553.3(u)-4.3(sing)-555.6(th)-5.2(e)-555.8(B)5(C)-5.5(A)-553.4(pr)-5.1(otein)-556.2(a)-3.7(ssay)-549.6(\()-2.2(Merck,)]TJ T* 0 Tc [(Darmstadt,)-307.1(Germany\).)]TJ /F1 1 Tf 11.9999 0 0 11.9999 45.3543 434.4377 Tm [(Development)-304.1(of)-302.4(a)-302(DSS-Induced)-304.1(Colitis)]TJ 0 -1.0394 TD [(Mouse)-300.1(Model)]TJ /F11 1 Tf 9.5 0 0 9.5 45.3543 410.4566 Tm [(To)-455.5(develop)-458.8(a)-458.1(colitis)-458.8(mouse)-461.4(model,)-458.8(male)-460.1(C57BL/6)-457.4(mice)-459.2(were)]TJ 0 -1.2114 TD [(exposed)-263.2(to)-260.2(2.5%)-258.2(dextran)-264.1(sodium)-258.5(sulfate)-260.6(polymers)-266.6(\(DSS,)-256.6(36,000)]TJ /F13 1 Tf 25.1537 0 TD ()Tj /F11 1 Tf -25.1537 -1.2114 TD [(50,000)-245.5(MW,)-244.5(MP)-241.9(Biomedicals,)-245.4(Solon,)-250.2(USA\))-243.6(in)-243.3(drinking)-243.1(water)-244.8(for)]TJ 0 -1.2055 TD [(7)-416.1(days.)-413.9(Meanwhile,)-423.6(each)-414(mouse)-413.6(was)-419.7(injected)-417.8(intraperitoneally)]TJ 0 -1.2114 TD [(with)-247.1(20)]TJ /F8 1 Tf 3.2225 0 TD (m)Tj /F11 1 Tf 0.5729 0 TD [(g)-246.2(AES)-246.4(in)-243.3(a)-249.3(total)-244(volume)-248.6(of)-247.4(100)-245.9(l)-242.6(every)-251.2(day)-244(until)-251.5(day)-244(7,)]TJ -3.7954 -1.2114 TD [(when)-257.9(the)-260.8(mice)-262.3(were)-257.5(sacri)]TJ /F12 1 Tf 10.0734 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ced)-259.3(\()]TJ /F15 1 Tf 0 0 0 rg 1.9574 0 TD [(Figure)-259.9(1A)]TJ /F11 1 Tf 0 0 0 1 k 4.1595 0 TD [(\).)-262.5(The)-259.1(same)-262.6(volume)-254.6(of)]TJ -16.7214 -1.2114 TD [(PBS)-422(was)-419.7(administered)-421.5(to)-421.4(control)-421.2(mice.)-420.2(Animal)-420.5(body)-421(weights,)]TJ T* [(stool)-220.4(consistency)-220(\(diarrhea\),)-224.9(and)-220.7(presence)-223.1(of)-217.5(rectal)-225.9(bleeding)-219.6(were)]TJ T* [(monitored)-278.7(daily.)-279.9(All)-275.1(mice)-280.2(were)-275.4(sacri)]TJ /F12 1 Tf 14.5551 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ced)-277.2(on)-277.9(day)-273.9(7.)-275.7(Colons)-280.3(were)]TJ -15.0862 -1.2114 TD [(collected,)-264.5(and)-262.5(their)-263.4(length)-259.1(was)-258.6(measured)-268.7(from)-258.9(cecum)-266.6(to)-260.2(rectum.)]TJ 0 -1.2055 TD 0.0102 Tc [(The)-516.7(d)-0.9(i)-4.3(s)-1.8(e)-3.5(a)-0.4(s)-7.7(e)-510.7(a)-6.3(c)-3.5(ti)-4.3(v)-3.2(i)-4.3(ty)-516.5(i)-4.3(n)-3.8(de)-3.5(x)-512.4(\()-4.9(DA)-7(I\))-518.1(w)-5(a)-0.4(s)-515(s)-1.8(c)-3.5(o)-3(re)-3.5(d)-514.1(b)-3(as)-7.7(ed)-520.1(on)-511(t)-4.1(h)-1.9(e)]TJ 0 -1.2114 TD 0 Tc [(following)-343(parameters:)-350.9(stool)-345.8(consistency)-345.3(\(0)]TJ /F13 1 Tf 17.0794 0 TD ()Tj /F11 1 Tf 0.5132 0 TD [(4\),)-344.5(presence)-348.4(of)-277.2(fecal)]TJ -17.5926 -1.2114 TD 0.0132 Tc [(bl)-5.3(oo)-6(d)-517.1(\()-1.9(0)]TJ /F13 1 Tf 3.7178 0 TD 0 Tc ()Tj /F11 1 Tf 0.5311 0 TD 0.0165 Tc [(4\),)-517.4(a)5.9(nd)-513.8(per)4.5(c)-3.1(entage)-516.4(of)-516(body)-510.2(weight)-517(loss)-514.6(\(0)]TJ /F13 1 Tf 18.6967 0 TD 0 Tc ()Tj /F11 1 Tf 0.5252 0 TD 0.0164 Tc [(4\))-517.8(as)]TJ -23.4708 -1.2114 TD 0 Tc [(previously)-306.1(described)-305.9(\()]TJ 0 0 0 0.7 k 8.8381 0 TD (5)Tj 0 0 0 1 k 0.4834 0 TD (\).)Tj -8.0563 -1.2114 TD [(To)-252.6(evaluate)-255.1(the)-248.9(involvement)-255.8(of)-253.3(macrophages)-259.1(in)-255.3(DSS-induced)]TJ -1.2651 -1.2114 TD 0.0323 Tc [(co)-4.8(litis,)-531.5(lipo)-4.8(somal)-529.3(c)-5.2(lodronate)-536.4(w)-0.8(as)-534.7(use)-5.2(d)-533.8(to)-529.9(selectiv)-5(ely)-536.1(a)-2.1(nd)]TJ 0 -1.2055 TD 0 Tc (ef)Tj /F12 1 Tf 0.6445 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ciently)-364.7(deplete)-370.6(macrophages)-366.6(from)-366.4(treated)-364.1(mice)-363.7(\()]TJ 0 0 0 0.7 k 19.9081 0 TD (33)Tj 0 0 0 1 k 0.9548 0 TD [(\).)-364(In)-367.3(this)]TJ -22.0386 -1.2114 TD [(experiment,)-226.2(each)-223(mouse)-222.7(was)-216.8(injected)-226.9(intraperitoneally)-226.9(with)-217.2(1)-219.2(m)0(g)]TJ T* 0.0191 Tc [(of)-513.4(clo)5.9(p)2(hosome)5.4(-A)-511.3(\(Clo)5.9(A\),)-514.8(a)2.6(n)-520(a)2.6(n)5.1(i)]TJ 14.3821 0 TD 0.0181 Tc [(onic)-514.8(lipo)4.9(somal)-519.6(c)4.4(lodronate)]TJ -14.3821 -1.2114 TD 0 Tc [(\(FormuMax,)-441.2(Sunnyvale,)-443.3(USA\),)-443.4(in)-440.3(a)-440.2(volume)-439.6(of)-438.3(150)-436.9(l)-439.5(2)-440(days)]TJ T* [(prior)-301.5(to)-302(\(day)-300.8(-2\))-304(and)-298.3(4)-302.8(days)-303.7(after)-302.6(\(day)-300.8(4\))-299.9(DSS)-304.3(exposure.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 45.3543 157.9464 Tm [(Measurement)-308.1(of)-297.6(Myeloperoxidase)-309.5(Activity)]TJ /F11 1 Tf 9.5 0 0 9.5 45.3543 146.4377 Tm [(To)-306.3(measure)-305.3(the)-308.6(activity)-305.7(of)-301.1(myeloperoxidase)-317(\(MPO\),)-305.6(an)-305(enzyme)]TJ 0 -1.2055 TD [(pres)-12.9(ent)-507.4(nea)-8.4(rly)-503.5(e)-7.7(xclus)-11(ively)-509.3(in)-511.9(neutr)-11.3(ophi)-9.1(ls,)-504.8(an)-507.9(MPO)-511.4(assa)-9.3(y)-502.8(kit)]TJ 0 -1.2114 TD [(\(Nanjing)-363.7(Jiancheng)-362.8(Bio-engineering)-363.6(Institute,)-362.8(China\))-365(was)-360(used)]TJ T* [(according)-360.9(to)-361.7(the)-356.3(manufacturer)]TJ /F13 1 Tf 12.4724 0 TD ()Tj /F11 1 Tf 0.2208 0 TD [(s)-358.1(instructions.)-365.2(Brie)]TJ /F12 1 Tf 7.6625 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(y,)-362.4(50)-354.9(mg)-359.2(of)]TJ -20.8868 -1.2114 TD [(colon)-394.9(tissue)-399.8(was)-395.9(homogenized)-400.8(by)-396.7(ultrasonication)-403.4(in)-392.5(500)]TJ /F8 1 Tf 23.6498 0 TD (m)Tj /F11 1 Tf 0.5729 0 TD 0.3945 Tc [(lo)394.5(f)]TJ -24.2227 -1.2114 TD 0 Tc [(0.9%)-288(NaCl.)-290(Then,)-293.8(MPO)-290.6(activity)-287.8(was)-294.4(measured)-292.6(in)-285.1(25)-289.2(l)-290.3(of)-289.1(colon)]TJ T* [(tissue)-304.3(homogenate)-302.8(as)-303(U/g)-299.2(protein.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 306.1417 708.6046 Tm [(Histological)-303.5(Analysis)]TJ /F11 1 Tf 9.5 0 0 9.5 306.1417 697.0959 Tm [(Colonic)-344.2(tissue)-340.1(proximal)-345.6(to)-343.8(the)-338.4(rectum)-344.8(was)-342.1(collected)-345.3(from)-342.5(each)]TJ T* [(mo)-12.8(us)-11.2(e)-509(a)-10.6(nd)]TJ /F12 1 Tf 5.168 0 TD ()Tj /F11 1 Tf 0.5371 0 TD 0.0106 Tc [(xe)10.6(d)-503.5(i)2.1(n)-498.7(4)10.6(%)-508.9(p)10.6(ar)10.6(afor)10.6(ma)10.6(ld)10.6(eh)10.6(yd)10.6(e)]TJ /F12 1 Tf 12.8663 0 TD 0 Tc ()Tj /F11 1 Tf 0.5371 0 TD 0.0077 Tc [(xa)7.7(tion)-501.6(s)7.7(o)-5.6(lu)7.7(tion)7.7(.)]TJ -19.1084 -1.2055 TD 0.0385 Tc [(Se)-5(cti)-5.8(o)1.4(ns)-540.4(w)-6.6(e)1(re)-542.1(st)-5.6(aine)-5(d)-539.5(w)-0.6(it)-5.6(h)-540.5(h)]TJ 13.3974 0 TD 0.0403 Tc [(ematoxylin)-534.7(and)-537.7(e)2.8(osin.)-541.4(T)-2.1(he)]TJ -13.3974 -1.2114 TD 0 Tc [(histological)-323.7(damage)-327.5(score)-321.1(was)-324.2(calculated)-326.8(using)-327.6(two)-323.2(parameters:)]TJ T* [(epithelial)-296.7(damage)-291.7(\(0)]TJ /F13 1 Tf 8.1339 0 TD ()Tj /F11 1 Tf 0.5073 0 TD [(4\))-294(and)-292.3(in)]TJ /F12 1 Tf 3.7119 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ammatory)-294.1(cell)-291.2(in)]TJ /F12 1 Tf 6.8389 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ltration)-296.4(\(0)]TJ /F13 1 Tf 4.0759 0 TD ()Tj /F11 1 Tf 0.5073 0 TD (4\))Tj -24.8374 -1.2114 TD [(as)-303(described)-299.9(previously)-306.1(\()]TJ 0 0 0 0.7 k 9.9421 0 TD (5)Tj 0 0 0 1 k 0.4774 0 TD (\).)Tj /F1 1 Tf 11.9999 0 0 11.9999 306.1417 617.1022 Tm [(Peritoneal)-305.4(Macrophages)]TJ /F11 1 Tf 9.5 0 0 9.5 306.1417 605.5936 Tm [(Peritoneal)-302.4(macrophages)-306.9(were)-299.2(isolated)-304.8(from)-300.7(C57BL/6)-302.3(male)-305(mice)]TJ 0 -1.2114 TD [(\(WT\))-256.3(and)-262.5(PD-1)-251.1(KO)-260(mice)-256.3(by)-259.4(washing)-258.9(the)-254.8(peritoneal)-260.9(cavity)-259(twice)]TJ 0 -1.2055 TD [(with)-318.7(5)-314.7(m)0(l)-316.5(Hank)]TJ /F13 1 Tf 6.4928 0 TD ()Tj /F11 1 Tf 0.2148 0 TD [(s)-316.3(buf)57.8(fered)-320.4(salt)-318(solution)-319.7(\(HBSS)-320.1(without)-315.5(calcium)]TJ -6.7076 -1.2114 TD 0.0392 Tc [(and)-544.8(m)3.8(ag)-4.1(ne)-4.3(sium,)-536.5(G)-4.7(ibc)-4.3(o)2.1(,)-542.5(G)1.2(rand)-544.8(Island,)-542.5(U)4.3(S)-6(A)-1.9(\).)-536.5(H)-6.4(a)-1.2(rv)-4.1(este)-4.3(d)]TJ T* 0 Tc [(per)-12.9(ito)-12.2(ne)-9.8(al)-506.5(c)-7.7(e)0(l)-8.3(l)0(s)-507.9(w)-9.3(er)-7.7(e)-509(cul)-7.5(t)-8.3(ure)-12.9(d)-506.4(i)0(n)-511.9(6)0(-)-8.4(wel)-11.7(l)-507.9(tis)-10.9(su)-11.1(e)-503(c)-7.7(ult)-8.2(ur)-11.2(e)-509(pla)-10.4(te)-10.1(s)]TJ T* [(with)-312.7(210)]TJ 7.1249 0 0 6.3326 345.033 552.3589 Tm (6)Tj 9.5 0 0 9.5 351.4393 548.1069 Tm [(cells)-315.1(per)-317.2(well)-310.7(in)-314.9(RPMI-1640)-319(medium)-318.2(supplemented)]TJ -4.7682 -1.2114 TD [(with)-509.7(0.5%)-502.8(ina)-9.2(ctiv)-8.2(ated)-509.2(FBS,)-508.6(100)-502.5(U)-506.3(penici)-9.9(llin/)-12.1(ml)-501.5(and)-507.1(100)]TJ /F8 1 Tf 24.6285 0 TD (m)Tj /F11 1 Tf 0.5729 0 TD (g)Tj -25.2014 -1.2114 TD [(st)-8.3(re)-13.7(pt)-13.5(om)-6.9(y)-7.5(c)-7.7(in)-10.6(/m)-11.8(l)-6.6(;)-510.1(ce)-9.4(l)-6.6(l)-6.6(s)-507.3(w)-9.3(e)0(r)-7.7(e)-515(al)-11.2(lo)-7.9(we)-11(d)-512.4(t)0(o)-516.9(a)0(d)-9.8(h)0(e)-13.8(r)0(e)-515(f)-7.4(or)-514.5(4)-511.6(h)0(,)-516.2(a)0(n)-12.6(d)]TJ 0 -1.2055 TD [(nonadherent)-399.2(cells)-392.7(were)-388.8(removed.)-395.8(Adherent)-400.4(macrophages)-396.4(were)]TJ 0 -1.2114 TD [(collected)-303.5(directly)-302.2(for)]TJ /F12 1 Tf 8.5337 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ow)-297(cytometry)-304.5(or)-299.7(treated)-304.4(with)-300.8(AES)-300.1(\(4)]TJ /F8 1 Tf 15.2414 0 TD (m)Tj /F11 1 Tf 0.5729 0 TD (g/)Tj -24.8792 -1.2114 TD [(mL\))-229.6(for)-229.5(2)-225.2(h)-232.9(and)-226.7(then)-233(with)-229.2(either)-229.4(IL-4)-230.6(\(20)-226.7(ng/ml\))-228(or)-234.1(LPS)-229.3(\(100)-225.1(ng/)]TJ T* [(ml\))-277.9(\(PeproTech,)-280(Rocky)-280.1(Hill,)-279.1(NJ,)-278.6(USA\))-273.5(and)-280.4(10%)-279.2(inactivated)-276(FBS)]TJ T* [(for)-301.1(an)-299.1(additional)-305.5(6)-302.8(h)0(.)-301.3(Cells)-301.9(were)]TJ /F12 1 Tf 13.3079 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(nally)-301.9(collected)-303.5(for)-301.1(analysis.)]TJ -12.5738 -1.2114 TD 0.0421 Tc [(The)-538.5(R)-6.3(AW)-541.5(26)-4.1(4.7)-541.1(m)0.7(u)-4.8(r)0.3(ine)-544.5(m)0.7(a)-4.3(c)4.6(r)-5.7(o)5(p)-4.8(h)0.2(ages)-542.8(wer)-5.7(e)-538.5(obtained)]TJ -1.2651 -1.2114 TD 0 Tc [(from)-318.6(the)-314.5(Chinese)-313.1(National)-317.5(Infrastructure)-326.3(of)-313(Cell)-313.8(Line)-316.8(Resource)]TJ 0 -1.2055 TD [(\()-9.1(h)0(t)-8.4(t)-8.3(p:)-13.9(//)-12.4(c)-7.7(e)-7.7(l)-6.6(l)-6.6(r)0(e)-13.7(s)0(o)-13.2(u)0(r)-11.2(c)-7.7(e)-7.7(.)0(c)-10.5(n)-8(/c)-13.9(o)-7.3(n)-8(ta)-12.9(c)-7.7(t)0(.)-11.1(a)0(s)-10.6(p)-11.1(x,)-519.5(C)-6.4(h)0(i)-8.7(n)-8(a)-10.6(\))-510.4(an)-12.6(d)-512.4(c)-7.7(ul)-11.8(t)-8.3(u)0(r)-11.2(e)-7.7(d)-512.4(a)-10.6(n)-8(d)]TJ 0 -1.2114 TD 0.019 Tc [(analy)5.6(zed)-517.3(unde)5.3(r)-518.1(c)-0.6(o)5.8(n)-1(dit)4.7(i)-1.5(on)5(s)-518.1(i)4.5(de)5.3(nt)4.7(ical)-512.8(to)-513.4(tho)5.8(s)1.1(e)-519.8(o)5.8(f)-519.5(p)1.9(eri)4.5(t)-1.3(o)5.8(n)-1(eal)]TJ T* 0 Tc [(macrophage)-306.9(culturing.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 306.1417 387.6093 Tm [(RNA)-299.1(Extraction)-307.5(and)-300.9(qRT-PCR)]TJ /F11 1 Tf 9.5 0 0 9.5 306.1417 376.1007 Tm [(Total)-319.9(RNA)-317.2(was)-318.3(extracted)-321.5(from)-318.6(macrophages)-324.8(by)-313.1(TRIzol)-322.5(reagent)]TJ T* [(and)-387.8(quanti)]TJ /F12 1 Tf 4.4578 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ed)-388.8(by)-384.7(absorbance)-388.7(at)-382.9(260)-389.1(nm.)-386.4(A)-381.2(Fast)-388.1(King)-390.5(RT)-383.3(Kit)]TJ -4.989 -1.2055 TD [(\(TianGen,)-254.5(Beijing,)-248.5(China\))-251.6(was)-246.7(used)-250.8(to)-248.3(reverse-transcribe)-260.1(mRNA)]TJ 0 -1.2114 TD [(to)-367.7(cDNA.)-367.9(All)-364.6(qRT-PCR)-372.7(reactions)-368.5(were)-370.8(performed)-368.2(in)-368.7(triplicate)]TJ T* [(using)-267.9(the)-266.8(TransStart)-270.8(Top)-269.7(Green)-270.3(qPCR)-265.9(SuperMix)-270.4(kit)-267.9(\(TransGen,)]TJ T* 0.0339 Tc [(Be)-3.6(ijing,)-529.9(China\))-536.2(and)-538.2(Q)3.1(uan)-4(t)1.7(St)]TJ 12.9796 0 TD 0.0351 Tc [(udio-5)-530.2(\()-3.8(A)6(pplied)-531(B)3.4(iosystem)5.7(s,)]TJ -12.9796 -1.2114 TD 0.0085 Tc [(Ther)8.5(m)-9(o)-506(Fis)8.5(h)-9.6(er)-510.7(Scienti)]TJ /F12 1 Tf 9.5363 0 TD 0 Tc ()Tj /F11 1 Tf 0.5431 0 TD [(c)-7.7(,)-516(US)-14.4(A)-11.2(\))-9.1(.)-516(P)-10.9(ri)-14.5(m)-11.5(e)-7.7(r)-519.2(s)0(e)-13.7(q)-9.2(u)-11.1(e)-7.7(n)-8(c)-7.7(e)-13.7(s)-513.2(u)-11.1(s)0(e)-19.7(d)-512.4(f)-13.4(o)-7.3(r)]TJ -10.0794 -1.2114 TD 0.0112 Tc [(PCR)-508.7(\()2.1(Invitrogen,)-510.8(S)-4.2(h)11.2(a)-11.4(ngahi,)-510.8(China\))-511.1(wer)11.2(e)-521.7(as)-508(follows:)-510.8(m)11.2(o)-7.6(u)0.1(se)]TJ T* 0.0404 Tc [(GAPDH,)-541.3(ACCCAGAAGACTGTGGATGG)-540.6(\()-4.5(for)4.6(w)-4.7(ar)4.6(d\))-541.6(and)]TJ 0 -1.2055 TD 0.0375 Tc [(CACATTGGG)5.5(GGTAG)5.5(GAACAC)-529.9(\(reve)5.9(r)1.7(se)5.9(\);)-532.2(mouse)]TJ /F14 1 Tf 22.7308 0 TD 0.0368 Tc (Cd206)Tj /F11 1 Tf 2.7093 0 TD 0 Tc (,)Tj -25.4401 -1.2114 TD 0.0484 Tc [(TCTTTGCCTTTCCCAGTCTCC)-548.8(\(fo)5.3(r)-5.3(war)-5.3(d)1.5(\))-545.5(a)-3.9(nd)-547.6(TGACA)]TJ T* 0.0599 Tc [(CCC)5.7(AGCGGAATTTC)-555.2(\(reverse\);)-557.6(mouse)]TJ /F14 1 Tf 19.0189 0 TD 0.0607 Tc (Arg1)Tj /F11 1 Tf 2.1424 0 TD 0.6175 Tc [(,A)558.5(G)555.7(A)558.5(C)557.4(A)]TJ -21.1613 -1.2114 TD 0.0434 Tc [(GCAGAGGAGGTGAAG)5.4(AGTAC)-541.9(\()-1.5(forward\))-538.6(and)-540.6(GGTAG)]TJ T* 0 Tc [(TCAGTCCCTGGCTTATGGT)-463.9(\(reverse\);)-457.5(mouse)]TJ /F14 1 Tf 20.1886 0 TD (inos)Tj /F11 1 Tf 1.5993 0 TD [(,)-456.3(CCCTT)]TJ -21.7879 -1.2114 TD 0.0228 Tc [(CA)5.6(ATGGTTGGTACA)5.6(T)-1.7(GG)-522.4(\(forward\))-517.4(a)0.3(nd)-519.4(ACA)5.6(TTGATCT)]TJ 0 -1.2055 TD 0.0302 Tc [(CCGTGAC)-6(AGCC)-531.2(\(revers)-5.6(e)-1.4(\);)-533.6(m)-5.2(o)-0.9(use)]TJ /F14 1 Tf 16.1127 0 TD 0.0318 Tc (Tnf)Tj /F16 1 Tf 1.4919 0 TD 0 Tc (a)Tj /F11 1 Tf 0.6564 0 TD 0.0311 Tc [(,)-526.7(T)0.6(C)-5.2(TTCTCATT)]TJ -18.261 -1.2114 TD 0.0548 Tc [(CCTGCTTGTGG)-556.1(\()3.9(forward\))-557(and)-553.1(GGTCTGGG)4.9(CCATAG)]TJ T* 0 Tc [(AACTGA)-448.7(\(reverse\).)-451.5(Fold)-453.8(induction)-448.7(of)-450.3(target)-448.2(gene)-448.7(expression)]TJ T* [(was)-318.3(calculated)-320.8(using)-321.7(the)-320.5(comparative)-323.6(method)-320.6(by)-313.1(normalization)]TJ T* [(to)-302(the)-296.6(internal)-308.5(control)-301.8(GAPDH.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 306.1417 135.0992 Tm [(Flow)-302.2(Cytometry)]TJ /F11 1 Tf 9.5 0 0 9.5 306.1417 123.5905 Tm [(T)-6.6(h)0(e)-527(f)-7.4(o)-7.3(l)-6.6(lo)-7.9(w)-9.3(i)0(n)-10.6(g)-520.7(re)-13.7(ag)-12.1(e)-7.7(n)-8(t)-521.5(a)0(n)-12.6(d)-524.3(an)-12.6(ti)-10.9(bo)-8.5(di)-13.7(e)-7.7(s)-519.2(w)-9.3(e)-7.7(re)-526.9(pu)-10.3(r)-12(c)0(h)-7.8(a)-10.6(se)-7.7(d)-524.3(f)-7.4(ro)-13.2(m)]TJ 0 -1.2055 TD [(The)-8.5(rmo)-520.1(Fishe)-9.6(r)-519.2(Scie)-9.5(nti)]TJ /F12 1 Tf 9.4289 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(c)-515(\(Ca)-8.2(rl)-6.6(sbad,)-521.1(US)-8.5(A\))-515.6(and)-519.1(use)-12.9(d)-512.4(i)0(n)]TJ /F12 1 Tf 13.9882 0 TD ()Tj /F11 1 Tf 0.5311 0 TD (ow)Tj -24.4793 -1.2114 TD 0.0655 Tc [(cytometry)-580.5(a)1.2(nalysis:)]TJ /F12 1 Tf 9.6915 0 TD 0 Tc ()Tj /F11 1 Tf 0.5968 0 TD 0.0684 Tc [(xa)4.1(ble)-571.9(v)1.2(i)6.1(a)-1.8(b)7.4(i)0.2(lit)6.4(y)-571.6(dy)7.2(e)-577.8(\()5.6(FV)7.5(D-)4.7(eF)3.6(lu)3.6(or)]TJ -10.2882 -1.2114 TD 0.0472 Tc [(506\),)-558.3(a)0.8(ntimouse)-557.3(F4/80)-559.9(\()2.3(F)-5.7(I)4.2(TC\),)-558.3(a)-5.1(n)3.4(timouse)-557.3(C)-1(D11)-4.9(b)-556.8(\(PE-)]TJ T* [(Cy7)-4.9(\))2.3(,)-558.3(a)0.8(ntimouse)-557.3(CD206)-559.9(\(APC\),)-552.4(a)-5.1(n)3.4(timouse)-557.3(i)-3.1(NOS)-559(\()-3.7(PE\),)]TJ ET 0 0 0 0.7 k 45.354 737.518 504.567 0.28345 re f BT /F6 1 Tf 6.9999 0 0 6.9999 45.3543 744.2644 Tm 0 Tc [(Wang)-303.4(et)-300.5(al.)]TJ /F4 1 Tf 56.9126 0 TD [(Trichinella)-298.7(spiralis)]TJ /F6 1 Tf 7.6537 0 TD [(Attenuated)-302.9(Colitis)]TJ ET 45.354 42.803 504.567 0.22675 re f 45.354 42.803 504.567 0.22675 re f BT 6.9999 0 0 6.9999 45.3543 31.2945 Tm [(Frontiers)-306.1(in)-296.3(Immunology)-503.1(|)-502.8(www.frontiersin.org)]TJ 52.8468 0 TD [(October)-304.5(2020)-505.2(|)-494.7(Volume)-307.7(11)-499.6(|)-494.7(Article)-305.6(563784)]TJ -17.0811 0 TD (3)Tj ET endstream endobj 55 0 obj<> endobj 56 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 57 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 58 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 59 0 obj<>/ColorSpace<>/Font<>/ProcSet[/PDF/Text/ImageC/ImageI]/Properties<>/ExtGState<>>> endobj 60 0 obj<>stream /GS1 gs BT /F11 1 Tf 9.5 0 0 9.5 45.3543 139.2945 Tm 0 0 0 1 k 0.0235 Tc 0 Tw [(anti-CD)-5.4(2)1.2(7)-4.7(9)-535.9(\(P)-5.3(D-)-4.4(1\))-534.6(\(P)-5.3(erCP-)-4.4(e)-2.1(Fluor)-537.5(7)-4.8(10)-4.7(\),)-540.3(and)-536.6(C)-0.8(D)-5.4(16/)-6.6(CD3)-4.8(2)]TJ 0 -1.2114 TD -0.0139 Tc [(mo)-13.9(n)6.6(o)-13.9(c)6.9(l)-13.9(on)-13.9(a)9.3(l)-307(an)-13.9(t)5.6(i)-13.9(b)6.1(o)-13.9(d)9.5(y)-13.9(.)]TJ 1.2651 -1.2114 TD -0.0231 Tc [(Fo)-6.5(r)-375.2(M)-3.4(1/)-5.5(M2)-373.6(m)-4.8(a)2.1(c)-6.9(r)0.7(o)-6.5(p)1.6(h)-5.3(a)-3.8(ge)-376.9(ph)-5.3(eno)-6.5(t)-1.6(yp)-4.4(e)-376.9(a)2.1(n)-7.3(a)2.1(l)-5.8(y)-0.7(s)-5.2(i)-1.8(s,)-378(2)-3.6()-0.1(1)-3.6(0)]TJ 7.1249 0 0 6.3326 246.5007 120.5291 Tm 0 Tc (6)Tj 9.5 0 0 9.5 253.2472 116.2771 Tm -0.0225 Tc [(ce)-6.3(lls)-374.6(we)-6.3(re)]TJ -21.8834 -1.2114 TD 0 Tc [(s)11.9(t)0(a)22.9(i)0(n)19.2(e)0(d)-490.3(w)0(i)23.9(t)0(h)-491.8(a)13.3(nt)19.5(i-)23.2(F4)20.3(/)11.7(8)0(0)21.1(-)0(F)20.6(I)0(T)22(C)0(,)-486.6(a)0(n)17.2(t)0(i)24.9(-)0(C)19.4(D)12.9(11)21.1(b-)18.5(P)13(E)13(-)0(C)19.4(y)0(7)23.9(,)-504.1(a)13.3(n)0(d)-490.6(F)12.7(VD)17.6(-)]TJ T* [(eF)11(luo)16.8(r)-513.2(506)16.7(\))-510.4(for)-504(30)-504.1(min)-499.6(at)-508.2(4)12.3(C)-507.7(aft)15.5(er)-509(mou)17.8(se)-509(Fc)-502.2(was)-503.3(blo)14.7(cke)14.1(d)]TJ 0 -1.2055 TD -0.0196 Tc [(\(CD16/CD32\))-500.1(for)-503(2)-0.1(0)-501.4(m)-1.3(in.)-505.8(A)-1(fter)]TJ /F12 1 Tf 13.7196 0 TD 0 Tc ()Tj /F11 1 Tf 0.5072 0 TD -0.0194 Tc [(xation)-498.9(and)-502(p)-0.7(ermeabilization,)]TJ -14.2269 -1.2114 TD -0.0204 Tc [(intracellular)-426.2(s)-2.5(ta)4.8(ining)-427.7(w)0.2(as)-426.2(carried)-431.4(o)2.2(ut)-422.6(with)-426.3(anti-CD)4.4(206-)5.4(APC)-426.6(a)-1.1(nd)]TJ 27.4512 7.2626 TD -0.0211 Tc [(anti-iNOS-PE.)-208.9(C)2.3(e)-4.9(lls)-206.1(that)-202.5(we)-4.9(re)-207.8(FVD)]TJ 7.1249 0 0 6.3326 432.9637 143.4897 Tm 0 Tc (-)Tj 9.5 0 0 9.5 437.2156 139.2945 Tm -0.0205 Tc [(were)-207.2(identi)]TJ /F12 1 Tf 4.1714 0 TD 0 Tc ()Tj /F11 1 Tf 0.5132 0 TD -0.0206 Tc [(ed)-210.8(a)4.6(s)-205.6(living;)-202.4(F)-1.9(4/80)]TJ 7.1249 0 0 6.3326 545.8392 143.4897 Tm 0 Tc (+)Tj 9.5 0 0 9.5 306.1417 127.7858 Tm -0.0196 Tc [(and)-293.3(C)-2.1(D1)5.9(1b)]TJ 7.1249 0 0 6.3326 348.6046 131.9811 Tm 0 Tc (+)Tj 9.5 0 0 9.5 355.2944 127.7858 Tm -0.0175 Tc [(ce)4.6(l)5.7(l)-0.2(s)-292(w)3.1(e)4.6(r)0.4(e)-293.7(i)3.8(de)4.6(n)4.3(t)4(i)]TJ /F12 1 Tf 6.1527 0 TD 0 Tc ()Tj /F11 1 Tf 0.5132 0 TD -0.0212 Tc [(ed)-300.9(as)-295.7(mac)-5(r)2.6(ophag)-4.8(e)0.9(s;)-298.5(F4/80)]TJ 7.1249 0 0 6.3326 513.1274 131.9811 Tm 0 Tc (+)Tj 9.5 0 0 9.5 519.8171 127.7858 Tm -0.0187 Tc [(CD)6.1(11b)]TJ 7.1249 0 0 6.3326 545.8392 131.9811 Tm 0 Tc (+)Tj 9.5 0 0 9.5 306.1417 116.2771 Tm -0.0201 Tc (CD206)Tj 7.1249 0 0 6.3326 331.9369 120.5291 Tm 0 Tc (+)Tj 9.5 0 0 9.5 338.5133 116.2771 Tm -0.0162 Tc [(ce)5.9(l)7(l)1.1(s)-278.8(w)4.4(e)5.9(r)1.7(e)-280.5(i)5.1(d)8.5(e)0(n)5.6(t)5.3(i)]TJ /F12 1 Tf 6.1288 0 TD 0 Tc ()Tj /F11 1 Tf 0.5132 0 TD -0.0206 Tc [(ed)-282.4(as)-283.2(M2-type)-284.9(m)3.7(acrophages;)-286(a)-1.3(nd)-282.4(F4/80)]TJ 7.1249 0 0 6.3326 545.8392 120.5291 Tm 0 Tc (+)Tj 9.5 0 0 9.5 306.1417 104.7685 Tm -0.0201 Tc (CD11b)Tj 7.1249 0 0 6.3326 332.1637 109.0204 Tm 0 Tc (+)Tj 9.5 0 0 9.5 336.0188 104.7685 Tm -0.021 Tc (iNOS)Tj 7.1249 0 0 6.3326 356.2015 109.0204 Tm 0 Tc (+)Tj 9.5 0 0 9.5 362.948 104.7685 Tm -0.0222 Tc [(ce)-6(lls)-302.7(wer)-4.3(e)-298.4(i)-6.9(d)2.5(e)-6(n)-0.4(ti)]TJ /F12 1 Tf 6.1586 0 TD 0 Tc ()Tj /F11 1 Tf 0.5132 0 TD -0.0205 Tc [(ed)-300.2(as)-295(M1-type)-302.7(m)3.8(acrophages.)]TJ -11.3863 -1.2114 TD 0 Tc [(All)-293(cells)-303.2(were)-299.2(subsequently)-299.4(detected)-302.4(using)-303.7(a)-297(B)0(D)-293.3(LSRFortessa)]TJ /F12 1 Tf -1.2651 -1.2055 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ow)-207.5(cytometer)-215.3(\(BD)-206.9(Biosciences,)-217.1(Heidelberg,)-214.1(Germany\),)-214.6(and)-208.8(data)]TJ -0.5311 -1.2114 TD [(were)-299.2(analyzed)-308.5(with)-300.8(FlowJo)-298.4(software)-307.2(\(BD)-296.4(Biosciences\).)]TJ ET 0 0 0 0.7 k 45.354 717.505 m 549.921 717.505 l 549.694 717.222 l 45.581 717.222 l f* 549.921 717.505 m 549.921 170.306 l 549.694 170.532 l 549.694 717.222 l f* 549.921 170.305 m 45.354 170.305 l 45.581 170.532 l 549.694 170.532 l f* 45.354 170.305 m 45.354 717.505 l 45.581 717.222 l 45.581 170.532 l f* /EmbeddedDocument /MC7 BDC /Document /MC8 BDC q 136.027 699.76 232.078 -205.919 re W n q 232.596024 0 0 206.43602 135.522003 493.812042 cm /Im1 Do Q Q q 367.625 699.76 99.581 -445.663 re W n q 100.116035 0 0 446.676025 367.60202 253.572006 cm /Im2 Do Q Q q 136.027 494.322 232.078 -206.399 re W n q 232.596024 0 0 206.43605 135.522003 287.892029 cm /Im3 Do Q Q q 136.027 288.403 232.078 -34.305 re W n q 232.596054 0 0 34.836014 135.522003 253.572006 cm /Im4 Do Q Q BT /F17 1 Tf 7 0 0 7 145.4286 690.7834 Tm 0 0.00392 0 rg (A)Tj -2.0066 -11.2381 TD (B)Tj 0 -10.7857 TD (D)Tj -0.4733 -16.5 TD (E)Tj 0.4733 -12.0089 TD (F)Tj 20.2039 39.2946 TD (C)Tj ET EMC EMC BT /F1 1 Tf 6.9999 0 0 6.9999 50.6268 233.0645 Tm 0 0 0 1 k [(FIGURE)-299.4(1)]TJ /F6 1 Tf 5.0053 0 TD (|)Tj /F4 1 Tf 0.6479 0 TD [(T.)-303.8(spiralis)]TJ /F6 1 Tf 4.3087 0 TD [(AES)-297.1(alleviated)-311.5(DSS-induced)-299.5(colitis)-301.7(in)-304.4(mice.)-302.8(Mice)-297.4(were)-302.1(divided)-307(into)-295.6(5)-306.5(groups)-298.4(with)-303(6)-298.4(mice)-305.5(each,)-301.3(treated)-300.4(with)-303(DSS,)-297.6(DSS+AES,)-309.5(CloA,)-295.1(and)-306.5(CloA+)]TJ -9.9619 -1.3607 TD [(DSS,)-297.6(respectively.)-306(Another)-300.8(group)-299.6(of)-307.6(6)-298.4(mice)-297.4(were)-302.1(given)-307.1(PBS)-295.1(as)-298.8(normal)-303.3(control.)]TJ /F1 1 Tf 33.8949 0 TD (\(A\))Tj /F6 1 Tf 1.5631 0 TD [(The)-302.2(detailed)-301.4(study)-301.3(regimen)-303.6(including)-299.8(time)-305.8(points)-305.7(for)-295.3(administration)-304.5(of)-299.5(DSS,)]TJ /F4 1 Tf 32.186 0 TD (T.)Tj -67.644 -1.3526 TD (spiralis)Tj /F6 1 Tf 3.183 0 TD [(AES,)-302.5(and)-298.4(CloA.)]TJ /F1 1 Tf 6.941 0 TD (\(B\))Tj /F6 1 Tf 1.5793 0 TD [(Percentage)-306.4(of)-299.5(mouse)-305.2(weight)-302(loss)-297.3(after)-305.7(treatment)-297.5(\(n=6\).)]TJ /F1 1 Tf 23.8277 0 TD (\(C\))Tj /F6 1 Tf 1.6279 0 TD [(Clinical)-299.9(disease)-302.4(activity)-302.9(index)-298.5(\(DAI\))-302.2(was)-304.9(assessed)-298.9(\(n=6\).)]TJ /F1 1 Tf 23.9167 0 TD (\(D\))Tj /F6 1 Tf 1.6198 0 TD (Representative)Tj -62.6954 -1.3607 TD [(colonic)-295.5(length)-307.6(from)-299.4(each)-304(group)-299.6(\(left\))-302.6(and)-298.4(average)-307(reduction)-298.5(in)-304.4(colonic)-303.6(length)-299.5(\(right\))-299.4(\(n=6\).)]TJ /F1 1 Tf 38.0821 0 TD (\(E\))Tj /F6 1 Tf 1.5307 0 TD [(H&E)-302.8(staining)-299.5(of)-299.5(representative)-304(colon)-302.2(samples)-306.3(from)-299.4(each)-304(group)-299.6(\(left\))-302.6(and)]TJ -39.6129 -1.3526 TD [(the)-295.9(changes)-305.2(in)-296.3(histological)-304.2(score)-301.7(in)-304.4(each)-295.9(group)-307.7(is)-299.7(shown)-302.4(on)-293.9(the)-304.1(right)-299.5(\(n=6\).)]TJ /F1 1 Tf 32.4046 0 TD (\(F\))Tj /F6 1 Tf 1.4659 0 TD [(Myeloperoxidase)-308(activity)-302.9(in)-296.3(mouse)-305.2(colons)-301(of)-299.5(each)-304(group)-299.6(\(n=6\).)-305.5(Experiments)-306.4(were)]TJ -33.8706 -1.3607 TD [(repeated)-303.2(in)-296.3(triplicate.)-309.4(Data)-296(are)-304(expressed)-307(as)-298.8(means)-298.6()-306(SEM.)]TJ /F18 1 Tf 25.7876 0 TD ()Tj /F1 1 Tf 0.3645 0 TD ()Tj /F18 1 Tf 0.5912 0 TD ()Tj /F6 1 Tf 0.6641 0 TD [(indicates)-308.9(sacri)]TJ /F7 1 Tf 6.0501 0 TD ()Tj /F6 1 Tf 0.4374 0 TD [(cing)-303.4(of)-299.5(mice.)-302.8(*indicates)-306(signi)]TJ /F7 1 Tf 12.092 0 TD ()Tj /F6 1 Tf 0.4373 0 TD [(cant)-296.2(dif)59.5(ferences)-300(between)-305.7(experimental)-309(groups)-298.4(and)]TJ -46.4242 -1.3607 TD [(controls.)-302.8(*)]TJ /F4 1 Tf 4.3168 0 TD (P)Tj /F6 1 Tf 0.9233 0 TD [(<)-306(0.05,)-298.6(**)]TJ /F4 1 Tf 4.082 0 TD (P)Tj /F6 1 Tf 0.9233 0 TD [(<)-306(0.01,)-298.6(***)]TJ /F4 1 Tf 4.4221 0 TD (P)Tj /F6 1 Tf 0.9233 0 TD [(<)-306(0.001;)-297.3(ns)-302.1(=)-306(not)-294.5(signi)]TJ /F7 1 Tf 9.7433 0 TD ()Tj /F6 1 Tf 0.4374 0 TD (cant.)Tj ET 0 0 0 0.7 k 45.354 737.518 504.567 0.28345 re f BT 6.9999 0 0 6.9999 45.3543 744.2644 Tm [(Wang)-303.4(et)-300.5(al.)]TJ /F4 1 Tf 56.9126 0 TD [(Trichinella)-298.7(spiralis)]TJ /F6 1 Tf 7.6537 0 TD [(Attenuated)-302.9(Colitis)]TJ ET 45.354 42.803 504.567 0.22675 re f 45.354 42.803 504.567 0.22675 re f BT 6.9999 0 0 6.9999 45.3543 31.2945 Tm [(Frontiers)-306.1(in)-296.3(Immunology)-503.1(|)-502.8(www.frontiersin.org)]TJ 52.8468 0 TD [(October)-304.5(2020)-505.2(|)-494.7(Volume)-307.7(11)-499.6(|)-494.7(Article)-305.6(563784)]TJ -17.0811 0 TD (4)Tj ET endstream endobj 61 0 obj<>stream Adobed       \  s!1AQa"q2B#R3b$r%C4Scs5D'6Tdt& EFVU(eufv7GWgw8HXhx)9IYiy*:JZjzm!1AQa"q2#BRbr3$4CS%cs5DT &6E'dtU7()󄔤euFVfvGWgw8HXhx9IYiy*:JZjz ?N*UثWb]v*UثWb]v*UثWb]v*) b|'w&87]ɼN*MqWroxUܛ'w&87]ɼN*MqWroxUܛ'w&87]ɼN*MqWroxUܛ'w&87]ɼN*MqWroxUܛ'w&87]ɼN*MqWroxUܛ'w&8Qu/,Z޵_'۵ʻWtUl܉k<i:3xlUB_~$j;X9HӹPVekv_d\)nȍ*7:Ϛ5.ͤKK*M +#M=7QFJ R?̝>mfAacH$i9Lc)UVMܜU[B󎻯~s<e-="༆0K Uҕ+8G97w5G-Hڕ\Ud5lmq3(FR/47Z>0k'W#bNw_.by̺Wto͘g}*;a^?SCMi-b"xX4,qWK_⬓AVg\MPWybIi숄ҜwPK ?ߛ})on4}V$ _QƼYU{Ufj6_V7khAAy?ъs\m(7|Xq jQTJkVfɧ*AY]C)> ]v*UثWb]v*UثWb]v*UثWb]|9s޾2č%z V>ՊN*/Vzc86SQTU+\H#$'xϝ<0WmVIrS$BWAxayuOZbRYWEާi)e*m'Oġ1VmjH4]._K: +7 /)ڟb0ǨX?/<_MH n#W^RP5{?Xeu訴KUث$+ 73V;c=չ> |hqUȻu9E܋"i>NWZ ㊧1iy?3XHI[^.ѽ@Xӗ$*?.nnzd0$$pMDPA\U/TŬoi}ek2nV-F*"2t9ę-O (P7^v*UثWb]v*UثWb]v*UثWb]v*U Z~i scv+UY[8-WnG6ZCt/"K"-R}2J85늲+zIy#[7-ܱ'H~`iu:1Vv$hH_O"O/U[_ob;ɴ0^T RE`CVRjyjrie! + zr;o*7מx[kR 4†IEeB#f@>4^m/Ƀ8jg׮ ,rn[(hzK]v*UثWb]v*UثWb]v*UثWb]v*UثWb}Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UثWbRgodVz/ם|kR(GjbHt}* VXmbE]T1U,:W!2eiC jaQE LUNI-mRlUVw1, B*miz%)LUv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Uت_c]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UتF*v*UثWb]hfI Іq]#gUy+ LU~*UتŞYJs@AeJ_v*UثWb]v*UثWb]v*UثV$N^_S[D-$HT_*qTbX2_@4Jj`N*~ayY u~ Cю`@yΩ4>iy~8֖vy*@=\Uy-,A ޯi'fH-"p0x.eN*?=OyRmQ9+i+x4u"fWb70<ϧ~oh^Ois̗(:є<+N-?N+hW> R'ڇ,TH`yF0WNqWb<V]Aц!Z[oX[5*^ܢTs |bUثWb]v*UثWb]v*UثWb]v*UثWb]1UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]]+2G1) TQ*'ͭA9M&Vm-ymeDgP*^2Xyk˚~-,"2~> b "*_9K;HiSRFk|U)󏒯<sM*a=&ZGst2IG`SlUNPYAۣo{ean7YX*(>$tVfy+EPv`+RچS̐5C,R2T, gqGOn]ȻRӧSK̻XNmb~jJ{}QF͊X.jV\PFZWq_5i+['׽Uv.UsG,{ $ utR/L󞳪iw+.}a /}2̫R<1TWFj#g ZxWWu]7T[:+g3B#@j~rt-5Z)eUjSȒ"GwUv*UثWb]v*UثWb]v*U&|0'N*\{`8_,y]PB2T\}JUgGSP? yFA4(P5 *?=qTqi/25u; xA=B+\>_]i+۞&OGzW@?F*J UeM4_~ͼ4v~U~tξU~8o,c QzCtE1TSCKA_iWxZHI7ت#3ToaHOxEV \7)XS7yDyr,%“9YZJ/8eGϐ}IuFEڂRyT͚ڶM 1PLs@M1To0ƛ^Y %ׯoVfF wV=)b_Z֗hܾiֶ=)]rRd5U8Wb]v*UثD@'soh:W**UثWb]v*UثWb]1UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]Mbǚg&zݝ]— I ]*ɽC󧓇0hUe P@)'K?!n_"kq?eLЇۮ*9HGѷ#N*.m&<•vy[ .etՁT?%TCYoG~i󏗤v[L4OE=@aTqQ?=B[{,v[*?/4+%Aݍ̍"+*?>u!LvK[OGV&%jv?rX';{ۢEH֔P:u N5VX0΁yǖY}ZC)JVC-kMz}hNI,9P֬OLUkɿ$kzPWI֣k~I}O~Y5<[o*ד8wuQˠxv*UثWb]x7o3M淪F )iHZ/)J.^C[PZl:7*οKci&ѼN/T W˺w ⯫"WX] HbWb]v*UثWb]v*Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*pHAҸt(TV5;xm=82ư>;e~O\jȍkQ+&Tۦ 3iZ\ BF[(xz57VCO$ikזPGiEJ\U(>K/ǔ%hIlWhxm! M4 ?,ekv  Ob?.<ݧSi@Ԣ}^C(*vNzK{"^4 <A@*zb4g|:ܷ< VM6qW~Xy7~Z/5NBhȭ7*>J1[?01^|u6 *M|G8ڴ_vbgΑwiɼԧo_PePSᢏ U6]v*UثWb]v*UثWb]o IC~U(5@~^4kHd~̯3\Ua\Z\qL"q*8FtU Uv*o/狯4S,RrUCSbMyckhtVdTQbFOF*+x! !c K0E V=I|Um-&nR#iFvPȦڣsYYh#e_sYٲkP>B(ӄhʠ UBJ{{8!O,qWŀјE6ّ`G8ءK+XPV0O@QWb]v*UتWo0^.u]jtBeg6o UWSz|/Ֆ( 9^>y+R}4N4׭iF55>/z^݊v*UثWb]v*UثWb}Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UثWbX?헞4M>[E$Ж׉⬭"*HPNoUUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Uf$:>& CR3 銽CTi6 AVR=Wqϖ^kf4Iq.U AA8늽%eۛHUv*UثWb]v*UثWbUUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbT1UWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]%YLx?_v*UثWb]v*UثWb]&/^+bD]v*UثWb]v*UثWb}Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UثWb]v*U柑׿}'z^*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWz侸?gqbWb]v*UثWb]v*UثW`lU蘫Wb]v*UثWb]v*U^/]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UJnS]v*UثWb]39oK]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*_gQ1#T~U~*UثWb]v*UثWb]v*yPv*UثWb]v*UثWb]1UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]MbxWb]v*UثW~F#^|UxWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb^{b&UثWb]Ͽ~W##[y4Z?ZS\UꘫWb]gd/ʑz1FS(_֛~u x (jV*]@kn1 y,Djf2v`? WR[;H˕*G'#̱d^v*Uث|&#A2zRFR*UثWb^a/<-)2"y-?!|k3*1%!U ltR[:R5m3z;o8T֎sK.~V|jw_鳵LF@uc4]ak+M6{l$P QIa?woJM m)ԚH/!2تF5uI'6嫋-qi xDfTzv/4[I0SPqTV*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UثWb^}u =:FX7*2C_aMMy RMN*]cϽU6I7{8qWk$}40'憹m~ZtN\Xju^CkԓyӊX&ow RMN*]cϽU6I7{81<V1γz3Ԧ*4OMgMѬ4 6Or ZqLUCkԓyӊX&ow RMN*]cϽU,?泭wRo!7[O#R=V-7ѭ]ZM w|^d`mJ{bX&ow RMN*]cϽU6I7{8muo>qWK\.嫫ye)Vڦӿm5o>qW$}4?Ii]CkԓyӊX&oy34~ek嫻u=f2zR>6iCX&ow RMN*]cϽU6I7{8muo>qVm.J3}Ԧ*Gr_YqWe~hr|ƾZ#rާ Di٦*9i&ow RMN*]cϽU6I7{8muo>qW~lyBti]vIFQڀVU*kS_?i7ֺ. ce8K "nJɆ*2r`̡e8%.ȱW"F$U8 393u-=L]G DybZp՗=*8^do+ o!E[˵RZ@Fr1TqV;:$2dsɚOrqTY~Z,O|.*B+@M8|Iy*v_ZOuȕ މ{ UWgn&F0]D{,Vy"5]߼ZkTҵH (QYG÷LU9]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UJnS]v*Uث** U<1WPxb]Aኺu* U<1WPxb]Aኺu* U<1WPxb]Aኺu* U<1WPxb]Aኺu* U<1WPxb]Aኺu* U<1WPxb]Aኺu* U<1WPxb]Aኺu* U<1WPxb]Aኺu*//<^kyݜQW,,U@glEbr}(;]ҽb`uߜu+MCYid"ăW\RiЋ}WW+?ڴv(YVhYeeA Qb?ȟ'{v{U$'1!n#E̚Ǚy-mv0[ӌ ʘOyߚ>:eZC G&; ^ykݜҸ.M>;} 'jyxSry1&zgkccK ,PB{ Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UتF*v*UثWb]`lt-&}R>B" ٙ^]~{ˬyrF 0v 2|1WiZ[6,wH$e5 ⨬UثWb7FȺ|W7m*[,iHI~yv*bR$桩W]v*OΫ:?STFKTOJ ¼Z|^m9jӦGogfxY~L=VAv*Uy^ͦ]I%7<8[o۩1Vwv*UNK("RJ*ZM+-B93F>ԋ|U#d6*؂1Tv*UNky.'q0y yw8ˢB~L?Ue15Jt^{NezW,7~.+B;8WbXMd~H7 !Kt)!5?kv*UثTas]#ʰ#rY\(׻;X77<ի6|֝ Å{브pƧ32UثWbPZƳtږuf>gH4/7kai4< ,vH>ۧ,Ub]c^|~Sl.5kX-45/ݵ/4,?V*O\^2w:us֞$LqWb]x7jLU8WbTn--Ko26zCMt[ ak <@P*y"LWzQZ(N*UثVԫŒT|F*o?E)i//PpAFv=> U~Xybo"hD4Vnr㊲UثV+cRym0ƦIu@;y?F#Hܝ{w'{*UثWbgsUi,'\E%zk늱"gyG>CɶjBN "Abg]v*Z<˻kgu=RF'uUdnȪ_U}9iWvTiZ*z|wlUWbTh%yb+^'*?6>K.z\zZZ4xA("H*UثWb]v*UثWb]WbWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]RTWb]v*Uث VN=BWլ(B-> jUG߮*?QWLC!;-6žgUaR4 %ӥv[yJ BPw_U9]>r򅧚Ӯo,cWzs^?*)R_Fb1jqP:b_Vwkʋ+jlȀZִۈ.,-E' GЌUv*UJ+imdh*8? #VbNkwjSڙHU`)|U_-MO?lY~3 -Z@Y@b_]v*kHDrL#)`AmH@t=H #]v*wykgm%ܫ+Y\UQܓbʯ1jo1CYHO=neOdT⨧lUM$]ZXzk%XKIʈP⬟v*U jv:^q C-Z*.bq0/5_.{i{ ` zG$U#vo e;fS5cB;=F*UثW^-cmծ:'N*CFWN*{ =t^yIBk-y=*nPS*dyZwyzSȵU-/6ӊ֖vvmi [)1(DQ좀bثWbPjE[Q+LrDYZ@f(**UثWbCBѵK(ndATV`<*Ei(cXE4TP@bWb]FUN~HGȰ82 x-X`b~( 1ULUثU+[kw'AHPR/aH8ci:^ N4P1T^*Uتx^Ya7*#X,m}HV@SUثWbPͦzmE% {iqWb]J+oYdm[KxkRB">mm㵷_(P*]v*{ce}nװGsnnT:x1U?FtFb;DҤoqWb]CXFn+jsVcNQWb]v*UثWb]v*U^/]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UJnS]v*UثWb]v*UثWb]v*UتK-WT|jZUma/mjC0wqW0#GH?^*O{w 'H=׊hk]C R4s5?GW~ԍ#xa??FU0#GH?^*O{w 'H=׊hk]C R4s5?GW~ԍ#xa??FU0#GH?^*O{w 'H=׊hk]C R4s5?GW~ԍ#xa??FU0#GH?^*O{w 'H=׊hk]C R4s5?GW~ԍ#xa??FU0#GH?^*O{w 'H=׊hk]C R4s5?GW~ԍ#xa??FU0#GH?^*O{w 'H=׊[+ڞo/okIm*,~Я UXWb]v*UثWb]v*U^/]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UJnS]v*UثWbG\t{u?_=qT?1pLU=l/Z\G:*]v*UثWb]KXy,ĜleD䚝v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbUUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbT1UAϱ*In.$2O+K#nY'TqTVt="OZ{t8׼>*[]@Рn9x+'_⩖BEfk)[`&!*hVёL(,?1WJf9]"} qV#w9A?Ta #rP9= jG9*2խCb@ָj g3m]~f\[D*M e#؍ULUثWb>P/9Gp2M?``ynCTe (v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]1UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]MbxWb]BwN= _7^M{y5YݤcƸ+мn5ڌ6.LhE\ѴN>>FS.8UA˶6HG?N,[UҌc<#@Y@/p<<|٩zW+c B. rG^r`DAǼۦݹ, Uń]v*<+IoX۟k/޿dUGFK~@ےw_qWbPZaˀe Ir4SMa@ 3ƦG'$UثWbR0E.%4+@qV!Ϗ_1 j-.CsWz*U_Xɭs&UF@@|Uk^jtm2 FR4qڢi$_r[6h`i74} iT,RR][Dz柢 +Hƨ ;+EUIQ7idvP(Y$bOnfܕ8bWf⩦]WR]5xN @VR;TPK1;U)mZWRm#[lhHp7LU<皴2ZIy]o%V1T'q7Z}nlHa'z;.Q[/fEݴ~YZ [05튲,UثWb]v*UثWb]v*UثWb]v*UثWb]v*Uت_c]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UتF*v*UثTjZ5}`t_S{ҭ9[L)Iu>+Z!Kv"SWZ jB'0DI,+RРb6^S)R iˇ>р-->zQh-٨$2r.;+ӎ] S>ޅ K"rg#u%'iFԝeNbK2:Ix4un)pDOP^F2Gљ(YG@qWb]_ *M rC#!1Wџߜ'Xs^"rk8POڜI{6*U]2G)#J/$}bp~\`*!ss>NMثWb]ZZQnȳCo*aNeH ɿ&<^gJ}*!KjCKn\ 4A^ B#suPO*?3|5;ks'o\C3l?>X\򯝼mMV@#4)cM@ߙY70~`^k^]GzݒR:9 B*qTAͺuӕ^//?’d`MIt߾*Tt^ 8Ґg?_|bcƟ"Z7⯱wȾeWoƭceF~`]IcdSO)iVU/u$ud@ ED?~*/^GՓK1mL6#2 ձW~Nj~^K?f5\$:̳\d((܈^yCpeEge(/_lU]v*UثWb]v*UثWb]v*UثWb]v*UثWbUUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbT1U_5]MY ۖnJҲ~ٌ~xD]/B$֖{oФx. Bu}V}kbƗa'IufUXo!MwSHZiP̲@) %R<I<{-"~^kK魐Y^"4HM#z~X<;.H} U俖6s'o|}h 3CjP}v*UثWb]v*UثWb]v*UثWb]v*UثWb]WbWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]RTWb&8byd4DNT;UȬwv7HTЇGFU+n'/K no 1xq>"OW___}*b}):e|_x*:ZdhHP6銢o#0U$EG#"u5VA|]g[}vz12a7kbEK1 E ؤS`X#ʖG6=Nx=5f>& jCCyMMST~[v*UثWb^8f4'DvOlU*Zku}8U9L}R;'\v*UثWb_>Z6k<[78Vy1 ROƟʹ2n 8-oז<֧ *#(\W |U/7~YySz]C)L!%VX(ZeQ-&xn[]LFqnZCA& T'P'nQ.֚[|WZXT}3CYL:ʓ3KtRM[%֓-^IӃ+M~#VߕMTVmCSҢ3}تuLqjq7@,T@0jT|T/ˍ6lGQVa|f_M*hzt.Ajwg$;c^I4ʯ-/yۺYYW*}TIt+XmNwܹ@:svOWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb}Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UتIu֎KoɼNPL5)hتY^I{'\ML[gPBу o*X6Kfwȗ6fWez(qWK$ҼRHŝI58UNkxf^2u¸UU 銷*P>ӝ}8ye)Y.7UMF Iw<:IH ]v*U<|KjS4-&{U*pOFJ2J*u nZ uaчb1TG/׬/"#5IQ60U\<J8KeLcUهZT ~Kc*$mCҬGQr1UE4A|LUPhB zʦ1UI@?*#:p>%BjZZlGJ-?R;مGV?$.*Di3}z?"7eϖ"<~-p݊v*UثWb^g/4:kxM- m+T|UviA}h[kYat* 9|&se)m. z)bi_i׃6^֕S?+j~coBךl.1E$*9NgɚϞ3YkP:eۿbIZB#ƞ8o}w>c4o4ElZOfc& }@(Vbܐ'`7'y6}PXhD| nn#v*ռu] vB>_E$ݸbxզ*?:k^o*_c jy.%aG^"5B eY#4$<\ZVuv*Uثյ+ d}Jht7t o;d-I" 4U1Wb[͚Wo5/jm}fYxw0$}⬧v*UثWb]v*UثWb]v*UثWb]v*U^/]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UJnS]v*U%yGJH(zԮ*͡Yi+kt&Fe8 t"U4:0MZ3y^kt vxwosmsT&1U\UثWb]v*UثWb]v*UثWb]v*2cEQRO`1W$V^m5k[{=U?E ,(-ؗ+G(A8uy'-Os܋4"|:bm'F*Ǫ~mMt&K7aAʝbAYnb{XIYs \Uג?6%'<_)LK"QWVv1WS~oyc嶷 ui2"r7z&*Ե=3OA@o1VQ^-k}ı:hatPXGUe|{/sq^KU$0?fm {@WqW"~c~a_siaw YA#HT =:bUqkdl䷳g&$fW*L֮?/jrI!Nщo,*t]mˬyHy] JPeX$g ylU\I~hAb[?-[}fvno#S^qV i|ؿFm /뉌MCFI5༩еi>joFifU"ґ1^_#^/?4|֚VT 6 wSoG_2|Zv Μ SVBS?yZp'X[JVdWӈŤ u|>[_RĬORkLU(Լo/;5G%JIָpG(WڸV-SBSȲW%a\^ϊv*UثWb]v*UثWb]v*UثWb}Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UثWbPc- *# VUj3ȲUu\Uei3M-"pk*Bˇr3v*UثWb]v*UثWb]v*UثWb]3Zg_N-/.u=D!mC efE* h+_lU>|ҭRI6FkUIQJ}*=f C@)ފFP Oin5ch7A4Pk9#b c*ṱCWxmIb|HePWU1ka;;J#oD` I9C-YByW4Zv?:XpF"[iWUtfOAX-&e`WmV9Ps7Y&0:&r#;WM& *_VP _fumD$P !u;ɟulYѴh$ݶa^H</9q}C3~R,J/U$P$y:7]ԭ/bBqmRIdN] LU?675otB[T,3+KC huS-\>KTn=eiiiUXFFSA㊵2.w{Q r@-B6q]rXZjڥ5$'Vfߖ\w r[GȤ GjD*|-ChZX޾ga5Z\i9mm2~{y+Um7G=F+K6\&ꇖ>qUs{!]X^iQKXjPUk= Khmgb*w7Vt͖fomPERK%mŷF`GQO,~evx!t+*[S5X5p%f+J늰}WyIY_Ϩ4"V :Lg6\EƏ`*\LHbzbv*UثWb]v*UثWb]v*UثWbUUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbT1UY_0'`]CPkEG.\N*\U6uZ]i`K][k9*J@P*/zͥϚxyȣ2K"Z/^/]v*UثWb]v*UثWb]v*UثWb]v*UثWb}Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Uت_c]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UتF*v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Pz'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኻxb'* ኶ UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbX1m"i~qt-K i:}.uˍVVm#D&:I(O`1T~]jykZx[D@XezǗ<ɤyITҦm ȿn)PI"OLU3]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UتFkۋ(V@J< >hѼ]z[YZ#;3R+TҊ;⩍qoYQ]A b]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*iz^@5 LwRRʟaʽR:~`ySvZBK3h 1RO%~w~^Q^{$:XBȪ*Jj{U[h6֣n)E%nM%e)1Tv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb^Hvw$0-5~VC} *@Z瞩"jɦaGnVF)+F\ )SQC8#XP*v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Uث.-FQ/<aҿD]K5Λ-ُR(co!y?Z]V=W̺qA<шmb8Jr;ijnqVK:֓Yq={)d@n~XkYT" ^jʌJ0*i8Ee'L|"Uz-]iKE iA,4(L`QkY7ur"5MvYV1Z‹@ejhAf6$*K/$~`6n6M)>8}b8ҏ~Xͨ1? V̭ ϱ87G7.E)E(n*QٖrN5S"ږv]\L@ZlQvQOqWM3{c2)!V *[;Ͻ~[I xߨ⪧_󕟗d~g{ ZF$hwo$yoR  wڟFQϛ׿8/muM#s\07m%kqWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb][,C+qFUUQRI;*.e[Q5NԎj۩8-kNKoJ{#e#B8$5pF*o$y:w$HnQG!_zYL^ejU+I$6Y:.?Qw~y{fD֟kR~c:[VTW}PKǫj~_ѼϣEeEg[E$. ȪCG|Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثߘV,~I]:RKGQg~1SC9*/&y[LNмE֚gQpoTJ䇐\Kn<8?1yǡhipI4w7U}m.mMXjk],8~7f1rɯt*h`I)ܱ?ˊ~R*͆ rbwWbߝ?9';R_Tf_NW;x{/1Gs[KA ^geB e^y@=LU~W٥Eڇچdf[(EىZRGy'ZV_ev*UثWb]v*OtE<,i#U/Ry@IN |9oZU)`^)B8oB[GGM\UCo4#wL`:e+sS,6CwZ,?|>[BԬ}6I snNHثs(tWˑG&tog%»[\S~-h;?9?/9ߠTRB]ƛQ:k[u0goz7AqTS,UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Ud҈yJԱUcAZ㊼C保N=JX젽zHS>,U< v~`X'\|ZUxOÃs UN*>d~M*=V̒y ͒~bf|鏩yOxP'" yucCEU)wǚdk?,v?8Ɋ^ TA Sdz3^wP¼u$_w!F*s;PզF(g1ޛl%ʱ;!pXMϫJ]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbX=]u+oΛ/c G%8 *|UE530QNLK1=qTʺn|olj׶iw2P c!p:_ U)׿,ƕzMi䏧 Hd_⩮]#E72#{{ڍôS&z6Q{ U)t2NM UÚ;<gmbdϘ3^ږ"%"W9m*ך-Vttນ;e*0ibkmsN`RZKW5A O|cdڄGE+EYHA 5jj×Ei_UyQw{PQԗS%EQ)-]v*UثWb]#fޛ~h]*:zH@hTK[銤I_/r@h)]ŷt{+x7Ʊ(mk^]i/ 6dX'EmCP1DÆu'uS0[@P}ncu6;UEAuwqژU[̺..귺M 52~2 V݆*̱Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Uثn?+u%Btrf(oJF*vr {חyHȿ;&+|U<kǛF|nΛ9rt1Wb' ^ Y)2F* K[O/{kHR9}8bP2EZ^yDMG\=JZm mwjB8?9_?l|{&[( -e^ieX M F*ojgZͦH궕3n=|'w䞧q;#‹uju&ybj Ԭ=d^j6A6K/v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]xwo-.nLPKKAr-vV {bZ[>:w5/wss-lԥeŠ^84~|P'C6ک@-ˁVSlUhƵ>yUŵoR\K*'eT#*JnQօŵ.!-٢Yy#oAOeX~kF'Ѵ,-PT #48Kt;?ϸ87n i|-P"bQ07q Zs5pncOIQ_UYޓkvR$H^a[WeK>\Z#m0%WbkC튳o=jrCKMGpSYe.'T,u}"͡Lw{54f#@*1W*3&L`Z}E!F:DAX 8qWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Uت٥Hbyd45,(^?M-֚\\]hڙcs<=vYזu_пHX6xfVjMdUdZ l)x_Oͯi31W:ΝiTY#1V3/]kȰ߈^ JSNbb^ Vl%?-RKU5OUD|[wG|dk𵺊֑E$LMGA'Q:y[ Υq4+iʡdfU{v*UثWb]v*UثWb]v*UثWb]v*UثԼգyއ(($d`C=xfӲɓqw=\H_#|7um5}OKN+9 7YG/L`N[X]j;ǹ*"D߆kx?q}=bdy˞OhN|9rҽ\<w0[=|Β9#nh娢B&sVN̊ўq%nW6B7kcPk+v*UثWb]v*UثWb]v*UثWb]v*U濟ڵeD[b,Wmn!.2Hr6iMr[m5 jѣ$H G\peKCsMثWb]v*UثWbݤhgyo䳿[˙Hb$kN#u,ƾ2󯝞 ;ȚX}˭>e4,w91'>e :ŨyLV60OJ ǎܨ;L4Z[\rM7Vh'hT0,]*kSbHD|$I-Bn''Ӊ Y݆*Gq`IǕu%4bܥ1o"q45A)krzd#db,~jyNdo-^94YP}fpY޿ݧMFde֬iM 6jfYonj8P$㊤>.:.ow'쬟UWQG%SgxWb]yG+<+9ţBDy%@G%CTʾK%]/NLl4v`QVcV8Mǟ켭s1隥kƌPGUgثWb^u+ys*\UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*F $T22+2ƽXZ*$y_̑`kξ`Xiᴴ²GK^ a*7;ZyHƊOub>4 '}W^5k3U>_T9OOmtL> qzgJqWb]v*UثWb]v*ԮӮkXcr)ev;e`'1xA _w ~ENԕ.ٱL |V:^sO .L3g,U>~uEm*{bc_?ߑ@OsـhOĎ|݁xs{WCѴ3jV~`RI ̑U0Z1]{ L+ghsIㄥg` q2Pvj TѓfrFͯ~rh 5}PT-UO 82VE Ԓ={YO LIغDc!cf.[Auu=עr0NȠf8HwYI PJt,jd^i~^1[,i؊ &a.wprsj'T!sM\Ty|P F*DNq_.\R9G%,i1iz#InFy[0kX%f2ic>|Ӭq]v*UثWbwWV֖]]L<8Aɝ٨T rP!̕%ߜ_Vyt-biciGhĖ;t;f\Œ6Uc+AUJӰm6SRї< p܂TUy!;U95/4/u`vxYd%]M4R6XigC^jn2HYu;#Ol 5 9W1`T+# ޝWZ<]OOyE/UhaYoZNޘ"y͞Nc\w@*5a8 oz'cJ9 qoIȆ(md^FDUi_*y[,yɱOSJm3ȓ$A/Np7*/掑sT Znt^2& 0=d]v*Udм.X,TvGe>xƭ8^yVt2KeKdP'i IGf6VPMkצ*{8^hUh-Q,n(ɼhH<*,i:^3JO-2,2Т7*fUR@P*I1WK妲5M7JյKg[v9,VVycDn0fkE]%xK{UC AV+ys*\UثWb]v*UثWb]v*UثWb]v*Uث 󏙼Giz}{^;(XN*&M^y܇I3?M}{Gsc#@z}QU#.)܅[XccFpHkUثWb]v*UثWbk?ITyf]5}+i07.ҽ)zg5|ӭj>g\TjWBb ]S[ UꘫNԅo*N*/}7[M7[/f"B̭ڼ튽iV(F UEHEgoTqW~Biz_̋SIfK.[ibIaiDP2.O7ϯyWϺ ^T֟[ I/I* qTΚ旛n4?*zzƣm%`ѷ9d~>q<|\Wq؝C0qى&Auz~9! 4S_(9+7~)0_?]5}q^Bý%H|=Axc$O'|!tȬ#$iR{ʟ6ʵ20۔ q@jTPfǃ_ >X, @$qFIϏ7Δ^%]v*|-w]ff3OA35*nkb<:bWy% i55u#ې^En]{7N @늧8U]偑pI =D)OF*G^w.~J(=u H]oBM!P#E4liAѿ*-t]֭m.5p)Dy UZi"o45^YͥϚ!`GGRUzV*UثWb]v*UثWb]v*UثWb]v*U_Z› "L&gWnJb2(\CA&',d~)t}SVޯ{$N{;HԢ(^> xf^r;7Oފם{VWH}NK!m q$5&&lyb^"K:Əf:]W<3,f&n4`)O UWb]v*Uث4x~WæyS^dLшZF(FVxS6|URi_)p~o,Y.$_aCS[$I#gv ($1jqj7zZ_}\̪=AX@8ojnϨwQY[/9g`lU$ѿ1|C,WeӒkOƣ{S: LU7BfȬl q3PIVcrzbf/k^{ML/泞H+C,QαŖo/?V5^v*i&y(9 $1%1& ֿ7a0MfU§K 5t̛7X]Kk[xEDGJ9RZ÷r?3"Hݰ=vOO*XM?Y^RFR`,cfn2d>툿3 ."c}BX]/oyST?L$M?m8&_bQ5ď4Gpiȥ_V_W qZx"~[C+_nӳ}&dp "ongOgKҝu4EցpZ!oVj%WW+)GQ6".wA~pyM{mnKc-&:|eg?tRVr}_`.O5h._Y$O 1Ա^ǧYdžu˟e,'.IF#l#s\^\"4GsK qOQs9YNY̚;^M?fF^~|19=~C:w<ΡS/sȟ'4`F;:"tu0MhKF6?4;H>zmA9ɬ1!Qwl'πs)J0Qו!a՞MC\I@Kw㚑i_ QL 60}SyGzj2KvkL/*jh5GՊ&QWFcN|qLJ.n&81=D/)z^X|D&l#Ѽ˦Uz2[LZ)d?Kgg'$71;,{ 4mn;;o* |'j> /].A>_?_=_,~sy;BgҢmD 2 6 [u1~@!)㕑gy2z|NJp5{qM۸VMoExG2$T>5 V?Gټ\_|3#a~Mg,RLsxu_z)Wp4]Vfo=IWZFu88f qF/#Ɍ  ;t}%{}Dj׉% rw|; d,0{#3fLgKUsf /)|>Af:0dhԫ) #6H0ry@ ckWb]v*UثWbX/IMKT1PyV2E i#CG,? 6*--,"( M-֕nד1wEyh|,1WhIv}i..J';I/yST]RKCJk֣""%UE 1W]v*UثWb]v*UثWb]v*UثWbCp畣[18 [Fۂ?W\Cy}{jO=%yk45kXube[YB+V^ٍK>2Kӝ@˞G1m=ϫ|/!Yc(`ĉhۜg^Wf>EoՇ~QM$kUثv`>ñxnw6#Ym*F?X^=DѰvD5*rF7q=7<-.dYQX[8bxNd!)r$DdEj- iPf=" {Ջ|>1|C y淘'-UC1ZEq4FIv(iȷ G]2L8'c"=U9r]޹q͚~_[O*j^ӄ̐",`y3A5r[T>;|{Kajc\z/> 5@ogRW˓IVbK^IeԶSt;OV.%W6N"\PlQ,q/7$kvcآE5q# Y[wn7G,yѷ;CCo:9!`Jݯjn( '.8;XQs]7iZj Y$(yTP 9GhqLK#p_n)<}JWWsٲ*ܴQDY>סQ6@NCLD"0&_^7PCiZ|%լoj28NST_<ظN8Uqo˽o$;^A1[Ex7/A5۟jҐg7q]8Y0_FG^*PvŌ:{}˂;CSl8Gm^GڏPqotHXy {~3l>}c'0qLʈ:f=>YDl3U{oat5}foԀzV""O^m]81>b!u{+7喟>j_}vrYĠ ʥ}`s|a{:"7͞J]Vhm&_-7c upF@N٧̓:}ھ8O.q=Xĸ)cte'_͗<&McduH8LI2*C9jL?ɓ$d}&7v~Cӝ&le7MkRh 3{C ( r!f2vI8x)~6O"4[Msm ^ቧ=<Woe941 C5≰e!1ܱ/7nkmԚlQOVj@b 3'&< g<7ڝC%c1= Rmnf[jj}@5~fvNȏg^DؿG 1{w92v*y g5]A!M=U+G@y.*?'Qռ ],rY+)#ұWb]v*Uث53VpI(`<~ ^qTu5amWĚX ^s>'Q3B-軵 it-J&hʮҊSlU sϋÙ ے7+jv*Uث|ͫBM奅0ȚoI!7G2RU8v.|y`{^@HJyg~YhdmE#$9sk&¢2i9L2..CHg<ړXm?Ntbu;^nϵH_:ٮ-YŌy/s7u]81mVIy1!:JwŦ }areL!Vz{9ٹ'&IGUg3 H薑 :|,8ݟ͉y:Ʊ}u'QF)]epԠ_չY8ECN0b5Y'5i{y:jY?jsM(Xf>\ZiJ'ſUH=~6 $G8 }{>a:b]>k~xG{=F-K\+^Nlc.LYXB_Lm|-KI#7>" $xUǎpoa/]k#C?hnamsy"I>Veq wg!( ?tf]ZzpxLoYj}Ňt~.龉x%R6yO:Zʒ\ޤ6U?pG5=X %!{_O(NAd(O뢚b7MnOxS͛Ogt<<?Q%܍VY>_Q%JYKi{cKޢ<6}rd2:G4}Nr>O-M+?AAd}`n,6 )[ Rzoj,!B7ID7ғxE=/BСΏ6vfNUx(ހ<pݧu9! =nN `"~{2ie-uc>v%HdpH"-ɞ*U_efbE]v*xoFמXLXDexs* JV(UfO+hߜ^ad?Fu X 4XzO,[A=k6Sg> 92"?[uJӦP^nM̗oFf/$JG?ia_ b.ꟚZMGJC47 PQ g5X֯e/?5~\ri~H ]D }&z_Jb]v*UثWb]v*yZIӎh.EܭY$WqV3q_EU?_0Zw4Vz~_j![mUxXؓ5AJ5X wˇY5-d˱$HsEx oYx.QҧtӴ1vʑ$PH']4E~He^ͭ#A5YShVDhtr 9ud|Kg[O6i$r+}XВ% S*.?7Gǂ˺ծws0ZX#j7&[9Sm>]v*Uic xu[/^Ί_RݙD{b9#H:0AbU!x,hTuO}K̺}Mam$㘆9!ZmRb>^<ä\X])YbaWS*iEk^^wrԥŢ6ĴQLW#*y'4b^dBGCц*?^jZcж5)[E @GG&N*0l~X}[zV*4=3SJ]B ʄt*b=c~\-gg\wyH{7hy>x--.zѴ:>Q~/5ǵݖj!Cu2b3cHFϒʰkzũƴC旴݉5c-O&4}*Di]a-O/K)}]%ͻS)W^p mϧ)pQL2b]Jv-;ӂ47:E}#*Z0@/?AF8* q46eay۬:f9*<:=g79s#GtSeu2.dv5/yQf{KXq,9f2e*I}k>R޺Nvn?)_cڿI['y̚o~Ǥk Ҁ~ I9TPSdc`x'=[Ǫ}>c?s<ǛazUDD=YGA`5֭bJt$mdgጓIcy#˚5uf}vtoT# eij cCg(c?*uQ2f'^ui)Wm*\UثWb]v*_ʛ6>/.ܭ| LBDr(nf ~~8;F-u#?WwtʜTUi I,ڶي#5yHWf۠)d|ϥce٦81J% *~S;yˑ/:ޡ-='VsAqn΂BˏEy_>aO|ɯ&KgQ؆%bބ&F(8FnbHG.Oo=r zu+gK+٪*_(ϾPwtyou Q*R2N"v8ڴǼw aUv*UثWb]v*UPTքPАw#|U^q֮շAKi3j7%IY*ȣuQײ{m}m8G59ʭC\U~I򥇔yzG!SWݪINWb]WEU踫Wb]v*UثWb]v*UثWb]P짽Ekl$7EU'#)-p, .R4Eɺ5ǘtZϘQe6s++Slk"sc鳺d01Kы3sF4{}OFfn0HQH@@0j4A|ɣV6:buƳ g])jbGʚNaxڭ|a>FsG*F9q+-:Ǜ5+?K㰟Izw&PDU7=U?T7sMT:M݄"ކV n5'*K0GHm4;[,zM d.`Z,ިr?cuS/[!,?F*7v*UثWjvaS^e֦71p7P|h=TgGƖ档rX|Dd}lUy+jkּ̺Yg6Z ~4|HIqVsyW毞5H/˭2Jf5(&L a˶*~ljWTO)wJmnbniKCsЁM0l~X}[zV*UhCQ_C_zv{n`|Qc*q>GNCMp9\5k#0LǶP/_H=|)dCY}EЅܟZn;"Q6=Lx˙;;'&Cǚ_T@ yV&w|Z'ȖJ8TN9&#'{ޏZVO_4yro-4][UVIqh:%zGMhgM>l ogn8t$w'9̹eFR6K,2fVUثWb]@ki`9!؂ C)CɌLQ4LgAkZ#<3]y~Vi:nN >:+xgziqv]87>C[噵DO0hd@A=st1͐e1 wyNVC$^v YIUyBJ\K=|5ZaƧlUZW|yRMîj#uIAȢNY*U㟝ߖ~kռ>y=R^ԨdqI U5e#lUIyzǒ4+?_M5Gm4r"89:Q~`fҿ&,eb֖݈KnJĦ*n~Bf3yMK{4]~UZy%͙TtvqIfv`ǏqWb]J7z-Ƒky2>yby#K qϐf {'p($HNTdK'3҈-5˶QQ*ɫGi42]@V;YW }6h2D].jrh;[:ާ^&&5c@Z͏e`i (xgRviu"qɚJ;ߚ}ϐhZDrǨlnniSU? wG6]JrѾ(mQ~͢j7ŏjz/wWmw{k%3QBPG,s~q??F(?#H&m1.|]\9d-h;qPٮ}*o$4LT)kD VAfGl'虪t]v*UثWbPce}\NeAXxDMsLd9{Z皗FT͡!*xڼ^%sχ~+֛Ƴ JDM x$_B~[G.q${`(Oª:|w0_/'$I2s2s!;v*^f?+Rnd@ wf+\z3F*2vU^[c]>ffmo,`XiDfFۍTy3aO1eh:ueS4[s*j;6*&?z_<m5=B_ڃ708(Hd~Ey~YX7NmNmd0Z{~Cֿjz\jZ03HX28ZI¼X"Hc:g-t=OV;8vMa6 :b%+/|TrX&+MSˑç`'%b퍭[ܧu*zRb4FK0_jVK "0D늧V^}ƞPo5-Ne:)M?W$!xdzʜIqUߛ? !i)%!+Wƛ51|UhEo|}bmoy, }2ӵ1V;5yȿ2>jm漐-pAnKQNg}_'yzvc^jպ`[aVV+H,| 'f0PlUb]bhO,qA>|zFvkݾ'|*߽h:q?3ݵwN~qWП^m]CNΛaY[mیREtt*Wbe_OO F&exi!Գo*--FbYԒ`?.?(E]v*UثWb]v*UثWb]v*Uv:u? kD.=G1d2dhe(}R?n4{[Zֶ]"(Ei1Js{sW spͿnZL&r,',O1 l2zdbN#<@2=_zv%|#/&)sFAҧy\Y%#'LUVDŽ y#nвNz4Q3.'h29es:G^WYpgf?Lzg>[Ѽxt[5wM4sz^[l3??ilP ,Z qcՓ.cWb . K6o}k*Io9\$jPkצ*,UثWb]v*lXg4(}G/^K#LʾlI|iL#Cpj",;֧H#_̯+E8'}+@imhN-ň}*v*U][MG-apy/tl蚼@45O)a 0OyBhW[9fbO'%VDqTWV9y{U&N 9k -Z|U?0l~X}[zV*UثWb]J̚pӵxLE b_Oh]TKIE6tUPh9-N&j7Lz캂Ct34KJO`^[KΔp^EQ $Cɍ$-j@Բ%w` e5?8{i~d c.̳^݊v*UثWb]y濑|1[\~]ݢ['XP`ufYrD's4lLӉۚoc1jYڛ k-2؅jOSGO8(zOXpsv<-E~Y#ȧ\厥tV i[K\%BiT svk?ѢntҢD[WocߔVnƳ;kXuu"(1Wb]fh$X\G1V;f 4z0$bDMJ>lK̺O'&+QNCU Sfta LK $d0ʔZ>]^WUjmTUA8}ic|!51Kxi#8K H hj{ U/k.~dyeyt-ttf,-A/"qT]ף6!'L5?q7c(6)y͖JR}֑>)Tjߕd8/3h1:ܺ$ie2) DNb2|TKta6vTǚ9In<2r˫ymnvAFc&OfNQ5Վ*G$jgTF2\y 'Z[4A[!6 x UoCDgU-fq b;b~HIs}u%ѵ\FY@-Webj|w%Cu Bn[&1J'ݱ4u銥k~QxV&\~V Z*UثWb]v*UثWb]v*UثWbX~uz6R\pG+X l3'2 w?=. G-A5_ ?1/|Ӯ[~[q\MGⶲ2CG"_l;#t 6RGyL'GbْH!JHPy=If\DьcB_$LZ㈕wj4Xs׉ʻŪB DqSd8&|xcÎ"1 ksWb]v*UثWbZfURB_?k?I'/Ll3:Xjivƍ*;C]a =ƑCvY`GK/-J j<;$srQB55!IR/?V5^v*UثWb]v*UثWb]v*UثWb]I=V6Ch_n*ˆ3\ifˋt>:yk%gpn)/ʤϨɂa]a,K F5>M/͝#Xj>c4IdD P 3;|g9a^sˆS@wR|eoʝ%V{77ލp|i癵md0#–sb+S^|kGz]Z*Z^v*UثWbXE,l02WUO.,;` PzNgXj~\59PWЊZ s lUVꚼsJj'_J.[*}ث^=^y~okH.VD>1Ҽ^R'|i%YC(O;\ifxԼ9c1!B"8'Ϡ\y(?MMusyym)gwQ>UCYcQQ_NC lj*)-jɴ $zҘߗ쮼çk32A ^-'!qT][;[gc6.=̼~]T 8ϔI2aeiu}8/!73-~3!)O7ں'\y5(Ud "Mv،U蘫Wb^u+ys*\UثWb]v*UثWb]=C[NXghFcKY&s]pLd,eڇ^Ig[]OR $Uu䡅ARU,E{/Sp)D6h9q$2xMC+  p1$cd{I}kl*e<hkcԈ)w;cK,<\<'~rhnvcq=qE"6'ew+e9g6À8 㟪Gmȭre>A%֋Oo}O{P,q hHUF^ _ FtLEqjf9b{O{Iڟɖro>׵h: K>]|WwdPGh4:#Ŗ_Tn3ǚTp Vui}Bו9Z҈1vf >>jd%w*?ZL '@C_]x-oYXyZ]jyEJs'@X?t6ǚ$yn |BuہWZwhH~׮a[ IާӊrN^`G %Jj>i_jVg lU~`_QE,z^*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]^qt}CK F\2ɦ *$7jcx,y| e"^)%yHŶk[WY|Mpn(W@Ǘ#P/Ѷ**G>JӼ*\.#7H)bA;bv*Uثο%/8]Q^v*UثWb$SN*o-:g$%J Zc,>n\?Qq,v*ύ:2Hs&):]i{xo4c|oQ͋ƻ|0~\Ks6v ysvFT4Sq:q\e{=efY$)tU%[s{'d#m1i~3egt}ٞGQ1 8YU/{{Z[9rFZSo-w?MK~_bG?0?:<%BkzZ~ON"շZ/.ML~}Է6*-w?M~g_ sQֆl#gj7 j L`׿>'9z U]k\֌*?_c/NɱU 2~zk'JԱރBykbykCZ sn%nHvLL~}Է6*-w?MRNWLֈy6pVMm 1TK~_b1Rߗ'sdتQ~`~tjz[ykD_nn#ȷ<⩿Ͽq;&]c/NɱT?1?9yLykD)ٿHz^K菋˵1TK~_b1Rߗ'sdتMb~se[J<ѠɥBڽZu5&9Qv⩿Ͽq;&]c/NɱT^}ƃuj^Z͕uȱ-_qMc>5uށŀa]NYTWߘs6cK n]HSqVQv*UثWb]v*UثWb]v*UثWb]v*UثWb]4ߪچbjQ8Z R9 $R8,{lU6gy"˶wK4޴*G+jG΃l^_Ziv%,hY^#{B]v*_kqW]v*Uت^#IԮ$<~;)$!b1gcR= yQƜ{\zIA(Tg1A]tsCzhߚO9~v+7G$+kov?)PܻJ? |b{GAK?}fˇU[xZn g?VCg74Bb=|/t?T<î0.d5s>fGQm<2W9l*􀤶Xw"Pr|HDO|19OmOd'/5im#ɫ̷ܓ6+ƕ,1=c8̺#ڌɲ˖>&L2HT#QoXOUtM38vN!#)Ԫ*(tUos4At?3#[!/˚om7RV٬h )gIz=sWÊ8D:\/zXqșnnȽ;{Ht(!D'քjz˯\`1c e0$e Ye瓮V-o1ymlkJ^A{vcG3jcbDzо-Ɋ~cRkG<{sh2=#VrH7-fZYS'>>I*t˃ E{bUتiX՛W Q{z|1T^*U siw:qk%[PdN#n( ㊢Wb['Lٯck9ȡ9%z28+v*;URn>ZeE*P(P1Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWbX?-|\qյtb5zƔE Y*h99&>< xH̃sT`}j6xbORao jCoao!ZUȗ켚Oӊ?TmuQ5]rz,L_4lҝo/Hr鏾\]FZ^ˉyO'./|:?4yb Ձ%R3"f>Q,BQۛF/TgrFU*%ٻt^1*UIkGp+\ON#e>'cjCeM֏ڌL~ 88G|lo~h%2MAy+H}_tCnXHJ;f ])=_Ø.]ã˖YeM'It6Lmv*Io>y噜̳^Tb]v*UثWb]v*UثWb]v*UثWb]v*UثWbZwTRBYu$67jiq©4NN*v*Uت7&OQɠ_7UWb]@k5g\k+7uYf qiWb?|)hWt}eDQ3bͽմ7V mETYrVb=cV4ˍJZ/)Ԁ7ff (N*9Z6UfIiQQVM40BL1y$rUTTN Uy?>y:ѸUǖ ơO*1Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWbR;j:ZXjjHZ^0]E_M6]w!`z'_˚~yJd5)s3Z\G4l*b|[뚗/u0^ہg*ı' (~bAXOfuTySb1ؼPȿiM\U(mmGuK,RYgO|U9Eԝ}-TӬw3*\$jO9{`7ў1jF2/5?Qgj:M"qɽUn´M"`MN7_lr\RR]uuiu52Ks'9YzP`ي"RO>6#CyrkQO _@፜)DV4#|m/#۷kVx/F bn/69<ϛyWO^+>YZQBq=}uGg-Ll2xBHx5'D 7;)9d~Y>~xwߨrtx4Nc/6>k,m!|g =WQ5#̸vA'|GE"GI}ha̍Tnҍ֣7z|0)qJgymoڌm:}oONS֭c Z6;t*w4^P/F-\RX`d'=x=ˍд`u"{*W/J - UE?p>K}=7o⿻m=.$YBā#,n7i lm1 vpFu͚iZ1k^V8!P)ƙT2>o(<}ҧvHco)@~88 o綱EZE|XXçF`H^9Aiko%`Rgj0\[GŻ>(X,/oT?/(o0Dj:ن/C:3սH6>I8GB$8G0}ś_wy=z|Z"ʓRVU%6r\=)ywJ-Ķ_IORhfIY<)4>]v*UثWb]v*UثWb]v*_k;cͺퟖ4[å5AQs-U|5*cWkyf|fXzZJ)Eԑy'&nIqfJWlŏ!P>T}H8tx{=JGÊ?yޯZ:nVյ mK H*7QH0 +>XeX,ѵU[TGno;znm7:#z:Ń&(ñUyMO,^pUaB|JT$Qqc syc W )XFt;PxX 3UjCmke9"kRLUFo sR[.H\*Pƻ^a曯5yH/ӾB?,Mݦ}ug YmY$D,Ʌ1Wϳ=E̺~cMfz̞Nb$TM8)mVgoo1IR\%'HakA4'ۨZҽWb"m|M3R[m3Sh.BzAhwژ:K*~h6yn-fZduUUzkE>5` Fh<HQJu-k% wfITNU;o˯!H'Mj-U6`A^5!{fiڮwctK{X::F*f=*ʓ\"Z׫lj\jqU?;~tϠ76Z'_4-Qh\oO C@ VAk +9E QpY DY{@ei4!(vK#'(E)Rva] ً'Ĩb^V4-rmNK9ѧh2^^riқW-2HWmmYf"?$ҶO-}d:m !QMR a>\IԗPʉHd&ߓ|dxcg"?&?k"#qV cZkimPbx?Y b͗È*o[-?DNPZȈUKI擬~ef̀/*e0޹Uފg"?(K[-?DN*u->k¤:2PO?mڲVOӊ=ղDG4O_>^u;Q@Km q0(4h6Ajw 痕BhE#?ZȈUFץ^(FA[d]`$M q ^VA?i"#qWZȈU 徏+ ;XNk[k֕-˭h: 8i?hl8"?Hwy-vd^ ?JTe3p\ A#p"D:uP#ނ4FgQ( 'v*UثWb]v*UثWb]v*UتNG5kъ?96tf1aQ雄iCPG w1t o:mJ`nTWb3O7-4 DGN\VX&#Tb?Zߚ}_/էi KD(%NRƵ&Ӽ/^7,ְLQK4juRG|U_}ݷt0ծaNst;C·e׺&ߞ>\.]C! V(2݈zUE/,cwNz{$ՙڇ{ݕa% , xRvTF*G#N[5U4 27Dc$7Y坟lyDnCLݖ>!kzgϦNlbkycϤŕJЭWmV ʯ[J?5VYsyQ$n0ppJWlUZǐ+|K(ʜSytC%P~]تʛ>|VZ#Z,+'H#jmAM,y ;0&ocp.ZUYA`>.lU7mU_L@z|)N#Bk5_hYjImp)*jWb3{Y{ aPd?ڸU},4A^v*UثWb]v*UثWb]v*UثWb]v*UثWb]J|ykQףTPiBgmVg&+mPS]³Šiycz{-/ʺMƁ{{fX$yԃ\UbRK$y>U-wϩrI ܐ#H^=#v_'qAG˾QڝgX/N{~nNlE{R_RaZhTeU"%e! ҃C^FѴKҴhDD8:yO;+{ ,M=NY%GLUnDbv*7oDu "%XxƮ\|W&h;_ϑq$Rݔ|JːbT-<꺊zZFj1Ҕvm䌜UL,Nѯ9ZUT0&u/tu!y/oaF^ލIYWXYA}e2\YƲ JGPA[yc#vu?UE?坵G6(huI~ HCzjۚ Rb<~Myʾw}k yķSҵbA A# sGfmwZ/Fղ?w|R1Ơ=)bdיt_2薺֋tzuUUUe;zb*:g~toak{xeEcLѤQW=~U~J{F:54Qy/ѥ,XT1]LUثu(3oZ󞫨GzhV[7%"$$SBy/NwewsMΎ\2C$P|jw鹮*;;KHo,K[Y`& *6 U~|[O'W7W9BwRCP9X7<0CusU|6HW35?ClUTwפ. 9+- zs HzU?z.^To6jituc,4pDj7ց~&*iCE[[.XAk/´P|M̺-]-x**VVF`:ZWູ}bGi#Wڨ1UO5&KOF|c~+rYoaoFv̵׵1UMWA,<ߠ%YygRH zBop䣱|Uqv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*U#rU][Sg%m}seⵞAu( BF*1Vj"K&yVе{=ֹM{tC#?6/Z^n~nW-RY$AV}bE}cHY=^7ٶiPJ~HO/T5Q=+TN*[>fAṧZIjn5QV.0K֝qW[_Y]"SJ:#'V]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]Ak{k^~'㴾%ee!d71V/w`VͧZkw[K'6*q,ceCΜ*E{Xd>ExcwʹAdfx*E}!劲o] 7JֵoηH-Ɲ} m^Q8w=v#|UXU;x.m嶸f9pqe`v B1U@ Ubų5k:Ʀ4-"ZIw\R=+w4[4HFydVoeJn|U=tJO.h-XU>HlV;c]i'n+kȌajUmՔWg,t!ˍ*C|7PyQUn_3O($g/$O-{_J lݥha͵)1MqVk{tuF)5"A ODhP+ qWyC%5H"\گaAN*˺Zdzj $}c:/F%.NF.>74%[F0?B+Y4A3REo㊨Kj{׭4yt;^A46+H# =^@(*N's-|դޖKYgv$+c;vRKӼua 5A;1c>;X#C M1VG"Mgɚ0D^o_ڦ*9VoW#QRQ>g RG@<W~^ʧ5tY&>BpۧOPYϚyGm]s h$($v%h"Lmc;kXG`BFઠ[>_:*,^_F(rmc7;zʸsO:'UkMJrHtF*|[b~e ˷&;Ő1^T1j07g:6kRBu4~akVV3),VꐭZoLQVRʊU^V bg˚m5Z .0X OriZ.N^4E7h*1Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWbf*|Y։wKCy0Ce ~+$n*Fŗ2I.uO9~\y[ԝ_1MVU{/އn|ϥVڅRHS-ObN·SO|$|~C~u΍5]B:ߕ<#P<ۣ'KN?u DʠQNgXTΚcPt-)Z"֚j8C#֝O^?jsJ V+CO3hP>`~&14sjq"jmTW)4-睮d:oq*Z[CoAmUdiԵm3˺iVдj:8(fo?$P󗝯:*˧+RXVʊxNGZUz ޗ\\@Mb[Fz ׏.,@jTi⨬UتD<䡫`hVTV/B^u>\~k*PP "I6'䄀h[zWb_Zy]swi[zV;aǐZubv*Ŀ0.l<iM-k')~>*W}UYgikl ⪣bc8h@JЮ5^ E޳0>Gf5>ߜWFIgd-m.Lע7 #P 7GsS" ON.m#L Wڋx&a9k״WIMVImmMɪZjU*<-cکnR;IٝrqTv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb"ӿ'hR ỽ՘#AjU02[052E{xXt }su7RrC6E4Rҷ 7 [p ;B]v*UثWb]v*UتA(}Pϊq?$?&LU,,?*PӯN >SQ~ckRiFKi faInZ!&wJ׮*VYּ%2Mh|V.=?'EfU/33^>Tw/|J[3蓫۴H¯^-Sن*ʴg 7.WryoL"e97'JLUyv<\dkiu>cƾ汼tjzh]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]oJ>`>u ,-*I,b(t疼Sc\jVrܼXޖ $"q+ 'WփΝsLM?.}){Ri8ʠnw'1U:O祅m.d%,6wC<4J%n;#k3C9)i4G֬a3[¬(_*1[yʾq}uYÚ1]#񘊊HSzƠbf:UO`E$THܒi\U࿚'< .Rk&bgpD,+ )R})j m ܰ{&uR|DqULUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb2#YA+:lU+:k5k{\zΝVuisk?& 0H4:Fʦ62"+Z#9p9صOӊ]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb?:ezV;RN&[\}cjy[rvm<խSph:oUn~iiӭ%nHmJ3>y}bTsjeJ(|x3ɾb<;2ON JL 4k`7&_rɯ1\<ѭ\銶hր?*NE~h:5 Ǿ1W4k rɧ*F77b7&1UnM{lkSt7$_銮_4k] ɯ*k5鍫C:]ī\wGZk}Eb5ku4U65@phzlU{Lk OMկF6Vǚ5X5L55鄫&_ճba*>w6-&!1V{Mկ>~>f0ڭ>gֆ}k ~K1wY?vLm\|Ϭ}cieZӿ99aL\UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]:pnbMRJN8Uh)o|J:PUZr)ȍ;b96+l@;ק!Z;Rzbr7\"FpWs y))N\Tl<1URq+ԍlB\/Qצ!\*wwnj;\NqWT|ph2۸[V튻c*@"l~45qV+Joָ)4U6**N5|+MUUwqWCOqJo㊴l ꃷJwVFu¬ɌFd=]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثuIS*u:h2dpӔKQ1* \/vVuC1?izSm)ʜINc!:8_ia[@1U*k׮zmrMqVQZpJCr$aUEo#;⫹WV U( \omR-cnVN)>MLcl1%~f<%bu!ݶT5gr;F# q}gL< FkI+{jbeXH@ {,Hj07IE.IH4<#*:$QZw4r\~9("XxP[[|[7nkyIcp~tw'q˰iojrvO@iy̠u LSl yQ:wd@)FoZ>QFZUv,:ryWQIa6mɍd˅j:|F%ܿT>4YGrIF_4er2B\s-|#'9qM0E͡j~ܷx}#$RI-Wdq8?-&!ې[zչFXdRfPD=sF)fts,tUE2G$R^Fi/6(Ň~@NCdak>rV!7.ۅ2g4%n֭Y$fnq5zlNl8V?~bRn2¤JR6ɍLgK6)vTEO5Esn ]ZZ|_pf423OpI p9"y\ ?!|fEDҤeHVOYoc z;P )%l6 'dP}+IrD;ٍBC`rxʓyGC16=~ZrHE젊~X"Ym- N0)JHߕsnC/-復-e: fе&nrZf? [H\_GC &XU`nϞɹþN~^gg=nv%\ {bUy7o$*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbw_m|F2,$ufwոԭRPhk2OvtumIjrCOBqWn>T7k.c`^NCڡV!8׮cogyL4S(,*OcR+^5 t;)-$E*Ǣ@ĢF#SP3`T6zէٚ٫NDFΪ Ty p+\~. F?kUlz\iZ Wb]v*UثWb]v*UثWb]v*UثWb]v*UثW#\O?HҰv,@ov*UثWb]v*+銥)/*=j 1o̞'*؞@WE:Nz" F3TCFSЌUiTΧj7wz*)  T^*UثWb]v*2Yl.rC >b[qYeH%$?s7v*UثWb]v*UثWb]v*f }.-əca.~9pcMԧg&gH""ˆrpռqlܸZnq|NRP U2'"H5~\N,DT~,t!UKAUwp+j 5'1USkEX*Wխ J/_ zWO|!Z?zS!W]Jy7|j^uռ1\-n-bP?}ͤGBI^zb9+4l<գ-T:%?RoۯT%TyiQO$HI/<k<0*~At;cwo~x\F'"vބP1TfO'!sser #UU3o!JָTԿ3cDM{MPKڤ!TsʓF3ּ~^_bZ܈`sN N4? O1i>R]Q_37*O7N?']BàdXt<q8w S'a?tw|U,:NnO@Wа:yq>*O7N?']BàdXt<q8w S'a?tw|U,:NnO@Wа:yq>*O7N?']BàdXt<q8w S''=3Σps̰\j1NR2dQM7YGIo.9O]v*UثWb]v*UثWb]H\?Uj:d2@r#tEkV,?A02iC(cs ~S@ƾAm nغ$I@xJzaKSFgYO)} ^qZ(y6 V#吧F1]F /UCم?KOU>`?-|Mx-``4G!+ߊ꿘~F/}{̌Q8(i4Ǣ|9<[^AA]D hwī@^PS5qbv!W+EAj*+_2[hi-%y.dGY 4 ܞTgU"w[mnhUIۭiSjcxVKRn!Yw+VUxTz2z-3ȠJQZWJ.<|j+Ke,2ܜqVKv*UثWb]v*UثWb]`v uIpH8!;} ƆWƸE[x0e/u_ w'[¨!)vƁQ@\BP;v8W^ث{ Z|U~/l~xki{V'lN؅^Jlr*:b Rh|[mQpKur껅zy(S*r ( k 6OK+(VXU K;aT/#yV3"hRF%Ye[Fzב 螟ˁQ:畼C!2J<I#U˚LOVgbk*A)CI6H4wtҤ5kERE=M֤t=U,?դUj,q4}ǥwVVD --I\!SQbČmT_2Ce q23IoWSv^GگLmQ7~Mީ=7{hJG@oh1Tqd%W kN8Ui1V1V ۿ\ Mk BGW;}8w¬ɠ~~?OqWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbOOϩk RJ*}I ]8Yf*?7,Htۨ h^Gz_]SMҍq}NxðSpwV=늱o1?\ݼ-sw=Κ.B9|j~R̯-~U^ѿ ,oiz1h.%gUdOIGR-#/Ҝ?I}{=^1T^*s:K;V$g u!EqV3ia,~[8 z3/OHYV*UثWb]v*UثWb]v*UxarzIOVmީgtb=r,} &BTxAQUɇS,]ࠍrybx3xYIB)̋`G=Uzqix_W4[;I_WrZ׾i]{l{SZt\x{WO]TNվ!Z$m^6|}U U8v"0+:W|4jң[tZzoh>~8)\U5*Rt®V#ni[SHa a+w®XR\HVӾgL _dUثWb]v*UثWb]v*UثWb]v*UثU ([Dd5.* WTo/7@Yc@I* jUFݮon#JgXTUU Av*UثWb]v*UثWb]|eW:f]94"5^|8hj*oRqW1Kc;o)Z1Gr~bzԭg_CHvS?/yP7XN*%8j뻃v*UثWb]v*UثWb]v*>8M^k:ipWL>"z-j;wLݏ]WVW5s1˕t6mRN(hyii֝fӂ* ZdIbSֺBTN'Q%@\yUȪb3@>eG,VcGDknXjۯ.qLTo̔`>d3ubpĦ} n#(gcр"Lj;V5k4Yo漘~[V:О3IYhGFX5=:c7v@[,G,Xv˷bIȝTKnUUޟFuAхZR`WL!\h:Z;}H\ZOSju\ uJ&S6ƒ*{]v*UثWb]v*Uɲ=5o[V(2b?..65^&N^\UM7c^ ^RӹkJ/@=銲|U󐟙ג]=.Umnl#*(?CU;b澵/;C׼__Gi.Liz)5#銽v*UثWb3*)f!Tu'a jU秛&_F;ʪaÍw&/3kZsw)r}d+#W.̴Gy7º׷` Ŭֆ(4VH(㽪Zzw5}<èfw>]ɬӀbf.e@y_7ijyBu {GKw,&12Ic\ËW~|U_hqI=Bu=ԶMgI2F*|UtuOpj1VWb]v*UثW#g|a&Z\Ư  _V]ª!D&bw^w柖<{7Sn"{+y-州 rw伤OMAMN|%>x+}]5䚥+GXQ\Uy\-{WךT0I@NGv=Gɍ,Z4f(j_bK?^=DZ+", ;Y=T,X n' 2-ZkR^[VIBRS1Wt# B0+ukc]AL mUJu+{/]0+{^تĎ4zVU qDۀN6Nks)OgL5ѫJ~H*{v*UثWb]v*U-{aM2X;Oz7(zBYL|+e-Īп/OmcS5䱬2ܴYbG!PxScz뭔VZb,O VeZujwO4$Z9/THA$BcO\U?|Z^S!Uݵ̒0&1q=iMW[;y!(3n²$ ! 'J 7\U_o0a:v, 4f:X忟0u_=plg--nb]9Yv {N]v*eWD<]IЌU~_7K3iVEI6U| ̖1wQ^F1xMQ+C㊧`3n GyJKՠ2,sJ2BhMmQ(W (*qTRмͣ\hcvѽh2ZTbpP M]O*46" (UM7䮑$4*K_^v*UثWb<3RB4tڷ\)^<~? Ux|umCeSwQ{(=TWeaE6חqR?vu*@\U~cu|+;Pt~3 N, b]68C!kz7tn2yytNOzW sێvl qWb^s[Ώ4Xh^Gy!4,zjT UR>xӡ늬w* (7!EOLUbWV6udn3R(MTUoNg{ؤwPJхS]CQ짽`BJ(zM{vXZ)jU5~@WNW:BjH hԓ(zO2U`Ofu("ԫv, v7Yw &h.#q`|[S Wr56[o+*3wxV*E0kpjkV{`*M7­Tև[v?F%VC^ؕg~L,tQ˯$*UثWb]v*UثWb.\tmND @[yV, XaRzTvP?-WO^r U[ɉXAKsqM..>*|?Wn2^u]{H=OF̾Y-vbY%[SuJ0̽&ͥwܵĞhE;դmV8!^D#ATP WyWZ#_ҿ-Sv*Uث$Iy0CQ1b'?YԼ2yyampč,*cSnh1T[7y0>*o+dUSw#VMk?O[7y0>*o+dߕᱹy,c+j%T~e8KHU *Y5$(.BOA*Y,¡cRB($Wb_4yZ9K{}SyQl-#bVTf6_>?銡C&G.jBI>$[K.i P^I#}y!bh)+Ⱥs?y ێt^eyۙV)WROn".P6_YUSF176eܐ^]{OӬGS,%J )")K,⹍6 +և2gw{ ø:}U܉; k튵Ȓyt턫8\v\I=>=U\Woۧ|V7*1^E+?-^"&SԍT-*!>aI]^PUjkV(UUOy] _iڻa#2[;KT:(kx D_{ 掋n4[uirC)#*r5VqgzUm,Ak p?#@iQU= J8z+uM!Zzj[6%qo"ՆJJmf]_ڵɫ JVcW=vUZmXl*|(Tv*UثWb]v*UثW~hg*RL-qh&#5|Tb/!͘1ȵ['RԢKZaq2?v qVgv*U~UֈbT]R<od`N*Ƽ^Q|y%O P,"GTS- ]#EO9H21H\U5hfA$2,0bWb]Sn- *2:˜ kn^WY 2l[eί=צYkַko aqH ;~.bgv/Tյu rm. Y-F f~GV]W~uy/\02^[xm[ BG`hdt{?䗛4izè_ipZk5P0j:z#v*[M#U׺i2rӇ-W{V*UثWbTXJè,^);(:e[޺#,a$#T{P; 늪]v*UثWb]v*UثWb]v*UثWb^}ߧ+>m*eI=)XǙ|o̿ |,%OīJlE8@B:мNƃ]קNm k>{vGSQaV{b|U~/U} ڻƇMI4XygVo^R詟|u1uHͽO쀤TnF cQv#5КwUU(gXr#RATa*MOEud]+d"YJ+;q'TW/݈ЎKy 4}؅D~UɭM-Bi+E߅>cJA=;hUZTZ=+`6*>[v8Nc"$%1Y{+=ƐW]OLi\6|1WQRv1V5ZY(T v*UثWb]v*Uث?O-X^yRM4ewYfY3;ثOY85Y\·0/e24Nr#lU~My_Z&{?e5;\Ic8#£z*UثWWZ#_ҿ-Sv*38o4Hϕ]qqxжU\U(8-.7%BN!zl#1V?9jZU兇宅HjpjC<II o* ?7r^ꠀ>$YS4:> MGSSYXГ˭}TʟS~e/ͺn4u$iɎ7WMWb]v*/=mGss,TIcAqt8bx{n*_/y ]BH`SG""6i|U=F4nrh;2ZAkB D^ܒ![HFVURM|U~*Uwt~h[q,Au'vd@AE&bh]v*2bGRv늼gSW0\SPJB!  ㊼g>o$yRLa2^${Wdrw 7ďz8J&9E ) iWz-.ԟj`h5.>m\&0G6q6,+㍫Mq^$Riʞ:O|AUިjP]UWpF<+J4{@If($N6;C4v젵i>D~do/,l/!A92t48]?GbTs:эa{_@*9e䆪hvKϔ`Ӵ&k5#Y p[i"g4X9MgchbmA\vSBWVnмikNTSBEh* UثWb+G핥[z*U⟗pEs>k -u=lZ5/rAMWXH#.ߣmbjlYGzǶ*U6&Yot,̔Bb$wU[O[ͦ\,Z"faȈ#ObpD\ܒ~eO\8Ÿb9?%t:K{K*K '֕xޣ{*UثWb/,o|-/ /0+&Dg`j]B۬V*g.O?`Wж?r|#Պ_z$w>-ڔS[&JG#]v*9#YK-42^@=*s^WuJF_NC-Ï*J4pd9e }"=~KyJ׼iepjڱSw9fKF:ex5eyGR#/sDхHMXf-PHu|#+߈/];[ȓ~k:]2IQ4Lܹq-v_J+-E&y uaibq/>,c8 q+O*&v̚>%IFo1H{YzXb]v*UثWb]v*UثWb]v*Uث?95 rpyf IIo>._+&@ZރәQX=I6ĕHㅕB*yj0RvֶQ^[OёeJz .-N ^IQ2l& Hꭷ̈jլ(y M: ˢ$p@48>` ƥw唝DF(5ǐG {Sz1 ZޛPb Wf:کn24nC #Y0im<Ʈ?})H9 mD$rkV XmƗp*Ƕ[A;㊷Aƕ J@;V0 M*qo iVrj`k]Q֧hV{~޿OqWb]v*UثWb]zh^oQ-/U2z+(&^.LDjbXjR>㿨Mi]V1GyGxJX]}P)x(@.cB53N dQ|V(ߖ*XjV I'蟪U}r]'zknثb_CrWJu-sitHI/pqW]v*/,`vZ-AzRBшOMHf+LUb]v*Uث \<Ηs'Idh}:3r|*1Wb]im@:7I$o&q}?tɒ~gSumP7NHI_'탩E0_zH/`s^m0*:;? o8>y[-CWb]v*UثWb]v*UثWb]v*U䟛6Ks=~?YFx ,hV+AR(is-#Ѹncie7؏rƆ~-%tSr2Tr 8ROafogy{`+P6zW6x y %M: qXbZ zM&HlW)fcEvCcm&*뼍"`bz e#I6~4[ջ'%pFR8c*u^/"]`79g~adTEv$ t` Ћv#߇f4 рPUOpc- @P^F(Lg` ɺL`bCr y+RbcHz9ӛ_#2Gz2`s ؓz2CI>9oPW+F91F2/P'x$O ژGTm< >)C`E2EJcBc M2adRZd$u +LdcO1]D MF\5s_0kſpYG\C4e=ǾfB|BڥDz96-7h;;bWlB ByT}Uqv]Wu&N*t=*<7Tv*UثWb]v*UثT^Pmvڜ#e[_UvX;~K$pI4̛d)bFд]lt{440[FܠbU_MЬ4H/6ztҐV[]Qi^潱T>mu$ڌ=J{N'KjXoG*(du@zr ~U~Rto<0en GF^x#Ͽzc^Ob7EәȪF}*QXT{}5Dhm"i"!97oqU 6چ5Ɔs/TGn|ClUU/u(nlTHъT $&bU DϨe"ڈ%*.8r }8|]7^yn䮗3iTT8~|Udٷ+v늽v*UثWb]v*<"w 7+gl:*]iȯ"Mo,?QSFNcK)Q*??nî?UTRTյ7[y~*~}XɢmP'm~t>wB"^7:ԒE*/v:cs \[Q9%䧡Q]f*3G{agKn<'?_?q龙W􄞎{yw:D[c%aWbQ8XJ1?OjV> 'ղ;R7vc2WaqV}+ڥմWeqDܙJ W~bMT_z^¤}fNSz⬣!&X|okj`bUaI4bO ȮF)bWb]v*UثWb]v*Uث0Zt BAC{+]l1Ju;h/^!i'- ? /k,.XݢE(LF Q.n,B{.$$!< N lmR> Н$Q;a+ [.;킕kzbǧfhmߡ8-hkZdظЭH۶*Ѡ[nz+d@?h8Jߦ+\UZ}vq**AG\J&tj$*UثWb]v*UثWb/;KKOeqzVE)P >UK\_Oe>pߗy|yY/a]m&Ft `8Ǯm4%8qHS\>̄;v*UثWb]v*UثWb^q9:J[Eo_lamEέm|$ч}i Ӝ Wv*UkP  ֜~w#,6UլX [|Zt!_.լ/eb[O&'NZ~f3hwenT(2cYNђa/yCۡ0w̘d@inPncuLU5ۦ)lSM* \J xb)ZTW@" c(~LmڳtZLToPQou +&bS;Uu+asGsT `Qm{07)ks1R-I(q%VyBo5j%+JG \JyJ 8- h~]5X;*n}H/$Fx ,q*g4ӧ8^>+) MF*ZXr; ٯucZdZԷ@P0:4qV[ʿzVlUꘫWyS[>~fiz}[EiR,#䞧QӮ*Q'h{~8Թ"}=ڞbjw19|m6ȴNlҨ_MUgԦCiۥμ˒}[[t7sǚ?*ktbYmK_бBa..M=^[Pz~b=fҬ./4*K4q#kKG*\UثWb]v*Uث?"[=HHTwg "Je#U|U-ȱW|U-ȱW|U-ȱW|U-ȱV/8[]y{=jWGa;Ii%"5Fh?88yfɥY.*?8?Wyٷ%1^s&I)O@e:o!']QX~#'탦E3??zR_oS8(*տgOIl_0W?ёgͱyT:]LIxK}7 mNJS9}[&3^b՚ 49~`d-\3v*UثWb]v*UثWb^s?oE7~=RsIx$=6Kݏ-0 c2s]<27*32ԏ+f? 7L N%W>A:PԚz잀B)F mBIciS⵭z eްd<Ict%'#X/Ri銯GLT81;[֠o]ޝqCt!+ V#ku-*=8d8Mt"l J] &}4}[G o-R#*)U5176Y-dB᷂oCU䴧+1_zM]YF4smF7n)Ў`fߓ?2׵[gkhmmt.,GzbN:e*hZ3^E$Phj⩤Ua L#"-12JSkk丕ĆGU'^;-9~n9,fF{H'쁷ywuM6+ο_¾/|ߦIq~h}ċ5V̠<(z}bA]v**DyZWEWb^+u+4 RքzAP"ֵT,%rkLUKyʗji!WԖ+Q~(ji**K osiϪڰ\+Rl2[tg$lqUY$'KMFno?/10BP(kT纄\ߤ,FBWW[ӗ/|U4rKH N)̺ۀ7JjSUH 1銽v*UثWb]v*ASkL7Rg%P[=b~ =:֘Sn&k]n&k]n&k]n&kR>07,X6Ac_U/<l_4%XJ46 qWy$?7s8_sq?3)M$v˿Կ"q/ҽ]tG/W~XSmP6~WTWZLwpi<ޭث"~&5; ou'y¥>P~tZnsMV󭻇dy3KZ{jR˫Wb`,TF?9 'J*]A[uSZ\yW>t4Km6i򌲯Rh0mBǧcB0ƄEkj+-G#o?!Q>u/Yyԣh>ZԴ[f>r3{&C/!Y:`?^r v4De"TG¨ ҝk\hp˛޳1Wb]v*UثWb]v*U~z봦P*V+jhFݰ*Lg0+%nrŕLO(fI԰S3ކ_˭_IE9&ߗ`V?jr`sy+JBCL}qc|fQE9h RҮߩ T4k׾i\W$mbv;_W:N=a'>O4?>ם>^] bW!Кƫ)gޱ]c$qKo 9`efS}o=2s}sNqB.Kx =Q=8E[sd ڜ1W]yp33@ iiE"$=¯R}JcWf $$}O>Fэń&v^G!\U+y5FE0 K[n,D߱8*mcז] x+dH 9$h½: ~ebмxospE7gѫ@ī:izE#R$znI$ UB /]VѮfEqm >58UyvɿZea({\FVr4={aW-{}UlqW|C+U"qU_>8ߋn ^_vī-uYYG'!qVYv**DyZWEWb^)z.ߚmfM._UzbJDijǥd-P|_-8iIʟRy֔?*0Մ=7I9rpN|ȽLU{p~"G?J^oњmVo)Lu!i_OӍ)zbc]Jo;-Ac7]]Ffh$Vylq<cڗ'y[-CWm ;%3A_!_0z1IRb.WK*+47{h7;rJJ%+ոGn})B#gFk/'^w<6@>K{.}H)Qd~ueB4K;eFN ʊӥkx|.ou.]v*UثWb]v*UثW\놟gJ8 Dm^VI]x^[uahR)OI{l{kEnӇ#6SÅVѻ- :\CW߶i#|RVC0~m[^U۾uJ֭~A^gH5U TyIl-wf)n%OlU3,m-EQ] Uu km_NLEq c]LmUt,e̗V^8w30hdSۦ*%ܗSP٣xQD*Pt*ޗ'MK/'瘭kǜM0"{V5~Bc cHn}I9S~)FZGuo%ZAY{UH8Y7z/&Y}$^TQ˵vTkkn'devCUtuDHS͘t8[s[ƶLxSn6-i:\ZMOw38C$1T֔pׯ|U7oQ1Wq TCq!]GbUy3a˯$*UثWb]v*UثWboκ5{{-)ysk$IA:lx)UG^o6kfgJv6l-4wPp5?bzእ>XRJ0}%y*"`fM-JWeYߒ|w蚃\O˟M̍,u֕^Ie3ok鑯GIo@(qWǭd4̗Q>9U UNdHӾ*矌NZ$SnEZ)ݒy9+LUCGh'N~H{K2à1+z\w;3=>3}{/YV=_ܽRs+V|hg b񟇨+ʜkLUz}UWz}UWz}UWz}UV/'Z`A ˁyJYK-6M.*qV!?͸U^f/DÜ?y2OJ.)}3 =u/KWi=l7.q ߖbx :%GUoGV':|O7ev*fF|غ<<Ϫ&rSYBGeIQkׇiu<#ɗ k-]dc/#D G*Th@\0GR [|Z\k~O6yDT"O,ПD:o~%Zc1?r3yyQ!$Yi`y\OrJL;wϿUpuWmZkX#_RBa (*NDWt:jFyՎ/!{{!,a~E;]N1 \3v*UثWb]v*UثWb^{FMhT}rc/C5u^~3{*z}*NI!Z$A ]#S ƴ8P+J]:mh,Au Tök j<0!q$EOs銸S㊭>MmHwqV ,ei/*ӿ^*Zȶ4[ hZ[^42I/u] )zP:p;/9u㊯~by5[HiI,6-?D?bWb#{ q%H.%΢H^KZ+/VO`lUu<gdثZ>yɱWʵ?|bc?X̞twkY ~nCqVyg͵K\U~pOn?yיK#c|Q037L?R˯otLBOGj=lK-+GOo1MgBw?oIQGqQ5UΟqjcڷC۝[=TXsQI'/% @2>W7h[ &2SdZ:h|RP" PWjc݋ {iI{Ie yWQ([q=c(ed~ӒfwQQhK Kcґ5 q@GIA-kOi$jcrN׏l  #|\}H-kO[JM!ig#hÑUd+(9Wϋs\3Xv*UثWb]v*UثWb^Ko06>3fێO գjrruwO7b,2UY_ 9T0H un4Nw<my!.6mϽPgz,jVhEIm#0u,?YMک -(QDiκLu"Bd{>dB y4 #AIe;|?Oi'Qognۓ^ k4oW~{d?<;_4ן#@du``p?yU4X0;5~i@I 'L0;O5^ҍ3< %@CCi9~c+c|rLh ҵέkHڕVP4*9oZS!Uw\zV$xt­(kխ{Uy38ÿa Wb]v*UثWb]`_@o9hkk3IIfP c2]V6ڴ~`I5jq5nBٶ늽 >Ra]W}NjZxc>pׯa#)@qkl^Ȼ19U*ִ r#J {}?UbHmpK#rYrqW϶^PK1v슚U]@x]WSߝvխl"LP[j0kSђH*Uث/awΓ H-%x̲N?LIr:,Q׮*u&eҟORP?..Mb n?O[#T}#RZ+e{n0DѬ(n/WUW[FgL6,p4f7PH뺮}:~6W2B`eyޡO4;R_M'Q6\jTk[,T ÜEBm]v*rZH_jޤSG TZO#^0߳Qf&$U)OLU*U󓯣G*MlFtTvژr;75_NSspC?Kwïߗ ,Uߧ?~_3TW~:}RR>y/ZADZJ4Y}n? qWYm⬗b+lۏ^uoH/L9~}Ǔ$n27?ڿOo.RlaĿ?Jv_"qн]a)O/@a_TuQv_jq3}zZbr57(vkRvAƩ4Gl&mr/Pk6+}x| b c䢿)bo!Y Qq1_5R;{(Gv Y(>ӖmcoB4[u_X+h~arIyʱFʦwHF7ovkh5:ol[OpTWE,7o SۄS_TmWd]*o5) !D%lF)Oo.oz̶.]v*UثWb]v*UثWYC*VnNE_<+U)Ok[ѯ S^ pߥwp BO_ծ8ҞtdPyz)S{/j_BO(EYU!sA~ҵvS ?[?i4rcFOS5ӯŅZOj_N7&aqNir#lk~ʥrWKj4 oZW/q8r)O ~=Jf>Km kлz8Yn?ʽLӺ˽iL%Z<ܜ[\E>R9W_vrS\?J›zޯ9y<l+"ث1Wb/;z^ğT~[o8SrYߢCjMz?{_XZ}Q?޷_^=pzyzJWGWkJq7˽qT$>Kz?Y~T~?g`Ec z*N\v^Wb%+{|k3}OGgG־|~)y/G[o}c?&?EWoz?k}UkվF// >_}WX_Ӽ~Z_[z?o|>U-9o> bhWtWSgW~T_o^UgbU]v*?8?Wyٷ,^yoٶiqVKim@:7I$o&q}?tɒ~gSumP7NHI_'탩E0_zH/`s^m0*:;? o8>y[-CWS+?~Ÿ+~=oƛr/h6A??YOY"?q}-*_b_u_U@}CHr_2#[^K5i#CVouk_}?+s 1<4+z_]y~vi|ÿO~ c_^iDӿE}K>Mצٸv>om.]v*UثWb endstream endobj 62 0 obj<>stream Adobed      ""E  s!1AQa"q2B#R3b$r%C4Scs5D'6Tdt& EFVU(eufv7GWgw8HXhx)9IYiy*:JZjzm!1AQa"q2#BRbr3$4CS%cs5DT &6E'dtU7()󄔤euFVfvGWgw8HXhx9IYiy*:JZjz ?N*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb^U_U᲻=Ua"9t UO$yN;yCNH#с1T][jM ZѮ\G=Xv*UثWbVσzTCǗJ;b-|ժZ0W!Z+J~"ypsbT]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثμiZlQis[QjiRv*~]~gkzK捀!we}8ԬyId(%Oثׅ&"CjAAb,nuy|-O߱ <~bZԭ?9[_Ymzi FOj]Mm ezo,'z*oֽ1TݪywWA4YVP7(;bzǜ|o3f jKt1SQy~Ӎa[z/ӪV"8.|OX?i q{m-EE KƈPPq] Q_|hrjZ'4e>ɹGT(vw=qVMe֮(K򅥟5AHჀmíi_unu]6쭭̦4MP^]R_I<mw1Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*XU1ȡ b-bOJ4 UWymhdN]MNgX*&wǯlUF}:]>x½Aſ&?-o IwHK)R6 F̄0=G:⪾VY?)٫C$k2f I%㕖:*z gWΨNh`W=iMTR`D!xͼ*H. Uٹ~grU%YTbw۩[̗wQYmcM*4q]Ns*tfn%ʈ̑_튡rYeݯm'DG KUPNtڄ6[dp$r@Lcb:1Q?%Ԟks"2z&nIBWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]i ƀw8Am(4idWXW٬]y#r:N+aq9*1&w*ռϦ{nO1am1 ^E? Tn?K4_@kl?-v0hY=\U/7YMg6ad,v35gU7o x2B#4n\k*lUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWg/z@ȇЎ٫a(yS7hi1f>2~~OZg8O?KVORTƿU7<;M&n j#thHfU/G:f eH:srPi&rMo[smƹ⹂A4w(TBqWf~P{.&P^߻K2@pfZ0Hn4V}E=dPz=¨I1=T~lҼo+A1QsJK S8Lъ$(`G$r1WhZ痿0Idքz 2:ɿ3[{7Я-LAiP!QZ^yqMsIc0 d*G⩝ol{[cOxD;qVI{+[]̑%JnQAuKWJhcN\ՆJ튾Q̋U.4twoVq֋dG0#0 *OPك:,áV ⯞M;B4ڥvѼQ*@O*?9>mԗG;ƷEfCP/kbU7/A`Kv1SP&y& Wh^bTvzqX'Q2T#Z|NY*UثWb]v*UثWb]v*UثWb]v*UثWb]v*yg{+cgj1V?//yOL{hR(q!l;_>b|FUfF?+ r?#<((xJTOݻVA'e#Em,qaHܶgr΍/E^Hv*#$@>[`E&мCp+鴼GơF{TZޙ_jZX`uZ:SlU^mxrb[(7sBv;)UN;+v@rcb&/$Z]_j[gucɊuqqTR艼L,vK34HI'&+iy[Ok(S^%-ۭEqU_"׶JӜA&nGok>/ UG)5+ǁn-An }6X⟛Uh7Vuc1ދ{qR2?ny0E^;7@ +,Fa@Jģ30P^dGQFZz\(G"vxo坿כ=k,j7o-7Q:l썈*cv*UثWb]v*UثWb]v*UثWb]v*UثWb]a.?Pl&F 'M!@nfWbwͿ/a`kp*ˉ;).'xcy bJ초V/HEET\5JVhֈ6=V/ Z-k~s#(_Jʾ˜VmBE>1f{VInHIq|UTd/m'TX_쪀*GRSX|ҾWnZs4"&o(Y{ǟ^[[Aj6E a􃊽3v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*3KmVK[k8&jhk+^sm`/#4M@ ;}f}:69~`l\pJTcoVy GAAtSIܞv`>ߔ毕y: ǐO">* ׾*?ʛIJ寧 ڞ U7m?3G?c׳"Vf H"=+n|qUߒ>bԭugڬt4M!? 3w1ToקyGԤ4[`'kt OU4/)53@(ʢby-qWXWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]iou-5[IJIVh,8`G]qVUY448 @e'rGӣG1Tv*k&%.*f@*4Ο+jQzVy;hF}hF+^Qb6Cj󭽸!y5wcT cN*oyj̨{RY>Wc^GS튲{_}GU-cN~ē V=?UATkyVڴV5 ioYdCU`>]v*UثWb]v*UثWb]v*UثWb]v*UثWbPꖰ#K,EI2E(y22<40jPyWڌhA*ǚLn#hiS|l7 pغLx"/Tt"vP^WA$ ea1-:n<&"gCr @(TQ@@3iu >}>k3XZI0 l+7nd$ueu b @NCtOQ蠚/#ضx_O'|𖆗 dISPsguq\~*M_>j/ f&F⩎^q_ 8Sj-b{ ORUb>/O>i>vVܢ!MUY_CZҵZu|TW>^t@?GzVN^TZm\UZtMS]6KIzH^8 O2R_=q[_}cX獚%ܤIrPMӋGl=O_8?%t*I)9ҵ IYb$#`=EGڴ_7 -4^j֡7FR~&^GXM+U~#EWcЍ늽W|Zwsi ݙ-AJrTZbv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UڝWGVUi_-kg50Ay2r$uYYSҎRXfg3{8KM'ڝֹVBCZP(zqLUJʽݏc}r8bQZn(}T}-bm,ڵ[,|bV-dGrjjhVe4?WRHTBc v<.*qWs:Q]jku2}q~_M)_We3s/mt&OT~q'!A*6= \ԭiU`,GM?K}U~@gL^\l>DAsjOت+fK]+S1H5(c~k2@hX\y7 _OGNG"VS+;, ثWb]v*UثWb]K"&t PH*]v*Uɬ UiS[ ev*UثWb]v*U!󇝴)>"8F0i"kP1TLX U$tz^,`+Sשتpo! J#WmR)yOUz!H1SUVwyʷuh SA݊?\|*NOW?J8py9?*\|*NOW?J8n [rzHg/M#Cҭg'TTbtiH9P\UNyr̟TύKs,&a, ,,aƧm}/O-kVz:snd7? 0f W]v*UثVmG^M4m/^CӏxOTQT*kwQI#Z3v*UثWb]v*UثWb]v*U1`@ oAK]=HaRAABPnXAO6G9qr.>4wxk~rSP{3;v*UتUo5iW}OZK[Dػׯ`b{+/.kln\A,)5zzo"*j(+S\UثWbWn`bm3U~Ek4KS.XE~UثWb]Kz+vW 9|v*UثWb]v*UثWb]v*UثWb]v*UثY5c.:vޙuoǒ]q(OT5a_1 TF) ⛅f%aFV=Em$&6:XOsA_px*;TuV2%͌q=3j",<0[&܃[WZk>ieM|-IuA,K2%K%xۦ*<< 'DS<:Ǩ[#Su(M6*U>@bߒk*n]m*$aBT}yI|Ga'mg5|=?U:ΩjgG>#ZHnY rSbnO5JlU-SIM?`)Wз'L%6*Y^˱/*/5M)ܦBxw_Rb]v*UثWb]v*UثWb]v*UثWb]|eKeOtC;5 >C+'ep:~*~ߦaf'$N9ۧ1( 1,[Wֵ"[jT߁ yسYͿ,*k?6_3v*ԟ:Σ%yv]69Uy~n*yGQ:-P\=XTtE =Sz^*ȟ.j&kzF}LQYXJX珕4]z6^$:B*,c*Z#$ly>4^s&z^Cjz|z3Ҟ7੧*7vQҭ-8Rd!n@φ*]v*<)]-%Tp(K(oOu?v*1a~XXӼy(ҙթ^c51VRDbux ; i^*XWb]v*UثWb]v*UثWb]v*UثWb_5YM)r}.ܗw|xOd-¼ z֢(2LJo dzg[GH-Jr&xxGqއZYA~}W bAUED9{c9Z2H˚{;|y+˺:[9x'F/*RL-MsQ7|iTFkfbs]B'y6N6*UثWb]v*U uZ]p( cO F+xn(cLU#pX?ZLU*UثWb]v*UثWb]v*UثWb]v*Uث}}ՋNWI;rTրМ܆.5ݜKs1h 㖞Tv?2w(MPrXmܚC[N4/65h3xPxz9pThn(בZК{&&!Fb,^*jsAiu4<+?YXqnGViY_ex>(ᇋ,tw߶*,UثT."qW9a=bJ]v*UثWbտ$/cԯciUܶs ‰"`+˺AP+/.NLdOgN6:˥跫u4XB7Jq >އfG֧isk[]:ۗ0* Vh:kzw'΢iE`%cPP^Y9/WPzkYBBS*9qqzEop:p}ch/=FښW$]Iy4E#%oM>-늱}'zN1۫ $bct?58qV@P*I*l4lu2&,!FTUx-qVQg5O8s&z^v*UثWb_IKgI7^YcH7jU?gW~j[9蜅!D<*/5$ߙzzç{'Mq{[{!甛Iht"ˤAGq}늬Ê:(F}5Xq+mjx{o$ZH<^v*UثWb]v*UثWb]v*UثWb]ZI$5'(ӹlQNw Qi囹nVIH 1?Qt9$!uy[4 I@{R2:זCQWTiS\ጁM&?,)ac; ~64 ^y"d3W~nMeyA"%SþlUB MeeqF~\Hۦ*,U'.=CsNޫ.AW"UKFƳzm^TsA#JSSɩ\U^t4mm]V[bqƪ[+4P qeK=Fm LaB2+z7튭 Ðۮ*[ʱ]-s{wˁ`P@Ejz҇11PyI-Q$MsqIȖhyqA^$p6I4>zkJ{ԚT1#W 8c?ퟔldyO=SS=&?=keV8ĭ Ezҝ z,'~LGҚKs<vNկ*Wu8l0\%q#N%%Qh늽v*/4yiG%٠Rv 8e+@'id1}327:sry.%tpǗ.!v+ÉP_i$lUxWb]v*Ug 0~U{-KO@6VE/Gbmej iֽyTd\qJˊ]5.?j} / vZԌ~V'yҞrhŮ<Q.ݱVwty[ cw>/"e^4*oH?$ڤ5Hw^v*MOIӮTw %V=T?ɟ/I3%tlYC}KZ*y[L&mg,ܨڼq*\svgWb]yN?ϒ8EpR)n|i85-.T BʁUXX宗ʋ^h'Tx¼SvS-{Z~h.%¢(B9ۦ*&iskn}fG2ZmӦ*?,:Ei*"G#LPU];x$GPI#Oɩi$)X/@]CVoWb^r5mN^I Jf@ud$ |\@><7QWf7*E 3TH3=vMUbFZ#f1wfڼ*Ч\, 42b3_3n~x*??4\P^^?yT#~iʄ۾*RcQV&xs&z^v*UثWb_e\LP뷍oC27aTT&s*.*UH\)4ju#𘾱D_>Un}o˘zk% ? ֤;/^4*8}$^\$kIWz*?8?տ_*<4KoU&R"ȵMaK|UoLSɷlU KE0}5wT6ʞIayWP*o!r$I0NثHhHN#PUX:KX0;[Z/LIop\/NEguS~cNH?QߘӢ5b?seο!`#Q:[[h'IOŤ|TWqWИWb]v*UثWro WI/E-oV`)iKdžsZOP׎O#]r@-1JmSMMioϒ4_YtK3NpK!б %JmS><7ߒ;_=IlldHfV<6HXC;+Wb]v*Uث+~[-Ņ{shqՔP:㸡oikտ0K/:ne0keD=ZǶثVKB-`8&8ѢLQkU埖ߙǓc{+®zUUGzތnuoqP'zV*UثWb]|g%& 'PFO#ϯ^BrFhO\U]f0[6_@]kC'8i(>*X[ϢyLqq3'׮:rRN mmn4'%NP\R8OTϣ\&[$'r,G*i85E1$O^Duo#ZD[n)żaoU@lU:5_W~/_^XMy/?Uy~T:xC-̈߾RV(h;늾]v*UثWb]y0?35>ݚmcߜ|+m[ugLiR)v Rkw-7gjZn` S {<٪,\Ks&;E{Cg4N[LUe/%X! KV(ʯe?~ mjד߾_b`~tdeTXm?KP9`Eh'ktK*=g Y.棋ӝ VZs}Q{^b]v*UتY(WoR[x7_F>,UMOմz,$!RqƞP?i$<}F^v*UثWb_M&u0E_"6yEAAZRtUTx413HG;zG: Uvy@ߖ0>9/(1UѽVsTdAT46Q~Z3(Z)bub~k51WCQ[a%kZd~_ӒJkF7|IE _LOOy^W~Z-7b=[oz^q9yڔZ9eTzkZ1Wb]v*UثWbOzm%mԋ~c.zq޻5Qg̡'n;Q>ܬIP҇d+]rz{L׈eCjѭ1+iͽgqye ZS_[ˬ/, o4iQkjsvlz&NN#/TT[]<9iEkoÊTvLQhu4ImmqƞB]U]Ɪ&O[9H]'[yj>o־G8=NѦY{FH0FdqV!(0qV[;&Ь ݍUn,@O| =aOrN*F;HlUQ,?wl?s&^}ki:BMhHxtj⯤1Wb]v*UثWb$CUiVM>IgNH~<8u\5B8Oi0u~]mOZ?YX9OZaYfF`8J);ߘ@yIQ&iӴooЎuqM?ۊdko.yTn}_GX[GqUߚ Ns.єfi#2ӏF з|L+S6ok4G 8zys(d/튽qO$Z00bZ\U;+ԏ}H_w]{@J#WX管K֗)iu%k^)Y!;Ӧ*sv*UثWb]v*M4_M i[zגy dހ^=k]w#Gsii-v!;Śk2Jˆj_eB}%j(ڢOԉ2&nOVy|Y\\ďi'$OɧX9l8ֺ#/5Vm<Ֆ-ͰADj֝z ͨ/CWb]v*Uuluk#9QG,$uX?Eb_N>7/*i~kěU4{:Y,3Z6Z]B'y6N6*UثWb]v*O/]XzY-7][%~^!MI捤Im΅Q`z⮸ωCFpOݟPmӊ0wizYAuaωӤF875<~,UrHi' x#mWb /Gc_gs[_٤&. HE>Y:_O+\UߢWEr+O<^FԟT}_G#ƌd4zb|]v*UثWb]uTF_ՠ DMfQ=pgx&kJl盅 H?d><{j#|٪Ɠ0Peඨ֘@_Qjt=z%CM6L^;|$PnaS$;^X(tSVE#j?9?%[8>vi[y8(ޯ3}^ثWb]v*'j?5#IJbA */o%MX^&bWnKqVM~~O]mt"\HQT# QYE:.*lUثT."qW9a=bJ]v*UثWbeO0~ad:sS?Ұ7H`a~}sG/EHlcY+ٛnqVE??ZtәXkeCXʷaH*fH w>xq_[ӏ9'jxVFz*?8?տ_*o&Mz4[!{ѹ~ӗZpn=|6S[wXo_5b-w}Պo|R\fO>U^FUثWb]v*Uث:}^Ơ{H岵QgڬV&=\)05@s(BIK$%L'6\$o^{EFG6!86gqY-^Vw|z$А&KzG>j${G_jJ> ult֕QpW!^JJѶ-:Kcא5C~~?eyu5ӛyK@~EYzv*UثWbUו˦y9HU$rnqWa)4G v5FA^xͿ>?6[h}n-̞+BY/#b~aֿ.m vo쵕Q9(`hXחF|UZb:zO8s&z^=" ~U>/9^!OnmQ*[sUփd 吮I1Wi?xlmt#I,e(ԕu R* C#~d}z8,onpJccQ*A{ nB?V].o/Yk#][Mo1 +P9sz!8%-NC;Co28 K > y}UK_̽A=ʀfƊ$LUZu^_=Zht^1i%@3zt]OC튭#βڦPAzTh$eN*_9LINH𬍶*\U~p#$Uy Whzi| h3ȬW*-qTZtNɱW~NI6*_i:O&^s9 $j1}=I!y~.*O5酴vm*H P9rrϽH!i튱7̾_M7KUW HH5?hH8{5'ֱ-KSq^euS{]Fd쭦r18Z1WyGp^Ѭuy5Y"{hn ~t]4jko2iiƼTx[Ԉ+С5*:*1Wb]v*UثWb]v*UثWb]n'ZIqD,һTө RHUvߚ6z'|略s{&ZW~TAbZlmW7SYኛ{~;2o{Ri#hYx=9/q$WƄثWb&?.Cǡ}eZY FdPLk(`ڻ|]b/Q<gJN&9cF"Fcu*vp<ϡr6skwn6P}]ֱWb]v*UثWb]v*UثWb|d0I{u4dWU($qWyyC>Z׭Ru~e :(C)_q>yʺ`ƾn,P#J-=A٘٭F*O?"_+[]bĢ"zIדuߩ늳UثVy[P2z'OTȥiM7^e/O,#t;#k;S<>G9G{VDPk1R=aѠo95QH)U;B .f7Z.g#"%HDQI'OWb^+m[FK>SP84Tđr]e-hSs%Ρ}+|$#c:7:(SY/2,^,D^D/@xUʩzWӮI@PJ^Qӟ(>>z*̴-BM^($31ܳ1%MqT~*Uت_%-Ò)gfcEDUݙArEu \\ 1qiTtzW|cDߡ,x%/*UثWb]v*UثWb]v*3?38ouf \KQR .Wۑ#ͯ.t b]KUV m0uc(UqW:?;4i NܰK{?.&~PgFam"aZPW W~&|v*UeԼ,gS2'>Pd^yp_`cw柖a}[G#[Xv**{ UWmGM}^.fޝݢr`+~*q'j⫦N69ᵸosuy*$dQU? E4tXm`EQ8Wu^cCbPDe:Vo#D]|*Jּe>d{bHmkyٕA{ʺF'<]yb BBnjAb}6!W=?V婕Lȍ܏a5Pv^)kc WX34_#DN<0ipET *0kd%x:qo)9a˒*ˠ=ZiUO1|6XyɟHiaՍ( ʲJTSتԮ5pOZً>S'zZ/J^6q|Ub]oͷ7hYbK%LV\{ ]δGt4˵-m@U0ٗ΍skk]4RXq:sZW~WlqT~j\]͡i7m$ٔF4? qTȾU i^yet^*LI eUثWb]v*UثWb]v*U#yiSiv{~ Q^RE[~˿&EzjM%x܅|6xvy^FW;Gk$ȃVa!Q۩9}^NNR*A8oc=%<;qlXyT6*O-̖jL=YOwq">el@]>GekAҪOQ=늽n8R*j,h)Rz]v*>^]5=W:fԏ~˔Eܴ`u#c'4X|M3?+TI.IVyyѥI:[x`J,0++ȕ4⮣5z40D#@UE_cjo)z\E % BȊ⫼|W$ZfC_z(P*iqmHbITPS^yz|YnTB-*εWi~T%u.RbXHE'E_B~gd8WbW&;GS0qWV'|$ӞiH\uicw#mg_tմ9#lwG^~=F*ڵ`[*y )[lUbe=BҾUثWb]v*UثWb]v*yq*";aՀ;zϺ-aN-&.~' T"4Um|>P/5&ī* Q =՞XJF#Ԏ~Ҧ;N4;b^-n;q߀A^Uz/I>,qTf*UثWb.-㹍C"eaPA WMt4\;t.^]Ģef6ܶF*>o墯bҴm&,Gb$$;QxWbOad$DÔjQ9vaҵŸtJmoqӨ?U`i$CƇ'⩷歋\yvxX%ݘ[wXH) So+jwweCz:Ttr6{|U7]v*yPyI.!$ 6aqr1V煥Vx1J `)\Uw-<2kEojyӔ(+ct튲+hYܰxi #&4SlUثWb:QGk+γX_.CbAӟ8ⴉnS>ʎ<5yy owZ81pαX?Uzo[ [nLK#~Ԏ`LWb]v*UثWb]v*UĀ*zb.&|_ɦxIV"H;ZFتWomawVv1:0FwR7bαyy]睝eu+y"|1U[ޔYxVE+KNU﮴˛e ~/Lou?h|AiUL6Ѭ`SNiݎLqWb]v*UثWbO<f2GSN;bJ?!֞aզPK @+/9WbSqڊzhp J|k 1 :oNbuӫE:֤ ^Zov*UثWbPimA)*Z 1U='@d1iڣP5@i UثWg~mK (4loԶGr`cXLUΏ*"7񛇠J}9k||k&ja"oIi?6ڴummuI5R:qR>˺:(HN1Wb]v*UثWb]v*UثU;hch'P* o9\#-4ޚOӣsE״]>Z~8D1?73ٱT}' Fچ"M&Zq;D-ġ3,ܒO|U[v*UثWb]v*<橬ѴVV6cw"S+ш^D( 1$*/5 K^Z^z$b۬[nS㊰[8Qi{=M-PeNG>qPmj/4[¼3u*B@JbeZ خk xs_SUثWb]v*UثWbcB:i ں\ڱ~y8f^quw~szZԖKan15?U.FZUW^k5~x|uTJP۫Bz*^ UUثWb]v*UثWb]v*UثV7o&E&&ePicu^cc^iiKon#AEU]v*UثWb]50i2 u;r^k}Zu8|s{i5}JX!.fUYXm߱U濚޺nVIR>O)*(y*:L#㉢ijcԏ UON&{da#<u#`C#Y*UثWb]v*U'wkzP@5!TIb/61jT=z;hjwm$p`;IH qUEX|s]7oh$b X;*HYgkMյ-=cH|ɖ՘leQ$qE=z UثWb]v*UثWb]v*UثWb]v*UثWb]v*;!ADcV;)PvQOݼqUVQ꺼K\"sr{*s*{ʉǟ@WU,:՘' ^]kgl|˵{1$mҬq* "8 KɞTIs(#h{(߹8!]v*UثWb]~cnwEUO*t8^_ë0[EB$]~ \pN'͊0yCT~Kti;%M8OVT ޥɼsW~4b)Us*<&S]P*t-#`{YVr fi }6wjp~ 4…Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWb-cEluk[)"7Fc*O/{|;|پ+Uz'g _o.?f٧QG oo,0{LI0B=HAJ⩞*UثWb]v*Uث<<|c^L71ܷP4B8S!Tb]tXX?3lU蟓f;1.3hݖ#"Դ΀,I~][eY*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UتTKI%D&cG>,#xo1VSv*UثWb]v*U$󗓴8ih~}Uu=Ny,0. ]KFpN+^CO1Ws:ZǛ㸸[!H!fY'w;v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*U endstream endobj 63 0 obj<>stream HWYosыqvl-,6` 1cc0NlU ^0''̰ N[J"<Gh(ґ$Rժ^F̣6޽o{Ս"1+m0Kp9͉q&iCH40C1t]=KL2[ +ʲ V`E&צlg U1 a >pi9.g\)-sJ;8=`Y`$^eȋ c I==*Q#)q-I"y,y 1Y4oif+,|eUZ>3ou\=e`9о ݣ㸵l5ccI=ӥOjQq`%\z8/{4v@-=I|kQ8${ݝnH6<)Ҹp|åeZU4JwvveØ`ؠKX̀]E7 = ͇vQ2~AF\|5׍GY}>mGUҕ2RZWL I8RUJ(zҗI+URNiҝtń<ɇŅP)$RrV, KI:cp9*l2|_wq8>J ޢ21 -EI\9]'@r^{Q½,^:Eƿ :k*p:R^FLx#v@KbE}A:}Q-lWu HKOBlkQ4"Eнed/.˷[V5 +`Uybr2z*I6dNl4Z%YdzlE4UJ5%Yֈ6بDYm d<DZxQ!Ak-rZ!I# &QWjQoV*uZ==QTV8A ̰VdKj|zJiT/*&xAfU?) w9>_Tq^~_?lo޼@h2 jm3?i}h4 DիW@۷`AMϘ >b~8[OOO?g h#鴇cd79t>! xz~;wwoi  o؇as}_}+?or >B6h?D*6͛`gO?e$k2Y/xF}>sOÝπ7Yv۩xM/.(i[3ܥtAeVl3*\GD]VrE>*e`RQ1efo3pfEn}yG)v cC~3fCkc؋oׅli#;"v`\Ex-h* & A &;sЃyiHuUVƃh ϧ\ōɃPk{oޖpk.Ҵ?/Fp$j& =g\;F3'-mLKL*d5 vQFIS>糶R^LۏxyruotًYMϔzw=;YGy/o14|ixnmC9?1<˨Kiu!.+&d' Y)J4Vh m)Vz/ m$->Io3l^3tM+. K0[5p|wRn'Ĺ #T ]U. JJc:9_!pJ!2Pa'ʾ^);T$Q~QǠhU3 MM5Vg}j,S6$ͬmq]I\+d"UCJ,)l4 W.֕(QB#fj*eumB)H-,n)둔^4k8q=ihk&{#݂I쑥1$v,\N` k}Zڬf)+,{/o3eۺ5}XI̩Q-}@M3`T#l^f1UQnw7ݗM )Qì8g|lt:˳Ҭweλ6{Y6#7`QaO"BDug5%[iXFev}`{>_#Sp5U\YHKm2î̫L׬.㺐uWǭa\aW@A.Z#]TPȺ-ͫe\mj+P)E59RޕA43[|м>R<+ q#喽c{RPsi|w?Ѭ9Ӳ'ʭYI|ޜ~ X2H:e44̀O`x:d 8IId2@$SpӊҴIi'2|=2 $ 2 GhD8i tx2R<#xHgW<%bܹsڝʦ_h"{+n +{c}z% %"y…/5\ =ww"j\DǙ[,nKJH@8P1p,Z|(_UGxWLS5:JErQQGCZ̚4&ͽ^UNʣK6NS-j.׶ThthiRD-P M4p^Rv_Qu1jvTZa_\Zbܳjy!e$/7)jrI2w +%aUلi5]f5cLr ؐX5f]xocLn^_{t  @GP> <cA hrB^'"8ÓIBk*>TZ ;0 *SKqaWf^8* +ª4ʀ:Jx ݼVZGCpyvn}s/LS+ Yr.\$tMH%R8so5SX;If@h@:端13@8(e/ھ_'F;xg5U6/:uW2]v(ǕStnoRqW夻rӫN;sOgrd4Ep5PX~,jYLCqzCOٖ쎆Ϋ%]z+z[]m5jjz[{wodߪ<՘{-ǝ@O*NԞِuǓ٘ Zץw4dt5^󽖼{w'{΍ .N,LO/> ,υVj(hd]Q! !MQ$RTUI ѐ".:Q1ns3kU IImKɽ 覿M V P"xbU*dE Q"!!FAwvbi t?/|JdYL j ֙ͨȦi:S,`p0oŅOP-Daڐ(tKoelԶ0ԬYctZ3谽ildOɦA7u%zꚅ)R Wg'F?nlʾRrމőtd .TfUgWdV_p},)/qgeVd ϹOח\Yk 3g/4MnMOEۍ7{F]zԽ2$< a&Q0&%kSX&V!W4tw`[cAp)D1d&?K`fl|QVa`erŌ8h M+Aqg lSݠZ75 ,`΋dZ|dNnbPG:6cXd`8gmY-|^( >`XSlHMGk>L;;;{rZX.]Ҋ^JqŒ7ݫ#-1~4lY8u%. @obot 68ȼz5f#Ij{z u/9| 8Mh;G6ݽj-S\~;fM}iˑR[.IQݥ΂sW*3kSjOT;R*Od/8)w {J33e57Tvz{Gg<NyVC+K+@o_^.ku vw_/sӓmkjh[?P|]7}1<Y[QJ$&֣*41D7R8D&M$6DE"J0M#*L((ShƵC$CMmZ$AiA6c PJAV AD_qQSM$@ oMQdA Q!"U#a5KY"1*Ͷiau]*!GmOSuiNeSW “ 9YLZϴ$Sl@vLPu6d$73Ҥm&oQxtj. j`U{8} ㏇ gO>y009:8=[ Uեoiy~b;;5 csSc SϖfKbpU 6Dt 3 E4Kg1fL)&Bdv Ԅuap0`c٪ pfh\̌LSUTmn]nlS3Loǥ aC#вJVgh8Ee K Y%Fes*Q*C'B\7 J\xzLA/Axaл;W'޼yvNs{{ѣJXh``۷{rS&7;AnL Þؕ-q~D-AC~>J */餙ロNd@_~,9vW$sh 뒙BdP۷h_N׵‘[;׺ڬK))k/U9Nf,79V\ZHu妕d/DMm,}SUns¦e]mWz;Zz^L[}~7&WT!H%(H(rr)T4)BZ5oaj̤o~J m$UaCpy9R Vr$Hph"Q%&K kQI[$iLY%І9- (B%:4CW)Kn@Mi0;odnb*Ȣ;cbMÂEWoC-@K[jjiA0c0@h4S;;sø#!bK]9r3f wNoysޯs:{ {6K$Rp,m5ܔpZ6t.c2ǽh{`ZaV8c߂˛r o 6Y8uФSUKXԪKyPW"PIM|}fNKVкUKJ*Aɬ AnKlT9~tڑKQ`UlnzUd8Wy)+ *kraijv5(%x6R\z]c~\"cJ Ka35H i4kzbt[+ݧ~NdW׊P3P8^ ئ[5NQt^0J3h|ˋ-։dR9A5ZFȮ)(4(D0ک z0^϶~^Y6+itV^kn+V nK{4. ~ddKXE5_m/У7 ]$7.@^~kSS׮TF&'w^2 W/۶mVhmo=sg'ch<c[?駇~þ׏}Vn|=nr=;ouGFNq/of'Lstw|:;zN3ս`t=x,LPIU "%g]uuCDNgNaD8Ǥ : 7k%4 %`|cCk0Wgͥ}0F`Q)ؤƱ k[)x9C@ڤA ˽!IDύYkMYi{s"u_(iInJget k=t$([ZKp<-^AeR5ⅵ 5׶_J6$_aijP1٠ApLmQ70C ?(sث"m]Vڤup["Vr$le9h}U:Z ЪdrӉ<y -{ y $@ RwxM c [vRlF1dzcBnPqn \>uCU༽5B`Baƴ2кψ$ƵbT:Q!M<5T86w"pnmf+A%~s;Z[$Q\dnD pٻ~w}T a۰aŋ/_\~w꣏>"xҥ1̥%sڵ+Z_њU {5_֗.F 7[M"mqD4$/_-sd[}aЫ ߜyɧûzxףl{Ccm7y7=-׎mn|˺׍oݰoǦ;=u_>̳O?uKgϾ֙>t:34st&\'(ՅFsq `su+5w^!`6^}d,}x^4i.,0'Q+fVTh^`E+ VgbU3̆&s3÷ހ:c?νƁ ps),rBڛi> Zg ^ nY`B#[1ǺN 96wE .}FfMܚAux w .e*F[y>*p.[b*ytǷsۅk fQ2mb*e+RTѲBeQ< XZf)m5ʳ{<5y䡰3eb96U@P/C!1g / [6yhZMKk-!/]XY#bXW)"TP2:f$^<ĂbdY[Nj o>2\!B\s=Er*ZiЮ,O:~ᇣMksRJ^.l/4·er4sժUWC1 9h/9`9ڹs֬YB-᫯+r>zH#;$#CjZ ޳Z/o?K/<#vΟ}g&F'l;:i}s]>c92vǡ{]w׺֏}Þ{n;8CN>s}ṓ|oљc:u:ss3\27gzs;{݄Y&+Sl`LPMV .Itո 4)B)"#`( CR !&֖`)]XTl_e3tŢ&,Y`?Đt2q}9=7: ܂a4V1 eIe,@)TfAhQef5*.ck.5|-!`%Q.HqU]WfrY#V7"L0eOkPjz[GSLN;PD)S^0}ApYsuVq9|rK털XL\%%XcT=I |aU'yPvdju;T%S,ALw"aSB@::L_qrub-1OJAlĩT2iYup@ i] +9qU\t:[y& *7`(kq;ſ1 ~-ZE1Gn#! rF"Jf]ANl/R(3/ r$ZOay1l# b{ 3?iS*__Ɉސj}Sٳgg+=.;pt˗/O!Ih.\Ng28d\Edɒuie5RJ \fgַƸ[on4b7B~G/^|{ddݼyf&1YkT=&Br3f!p Agcv}x楻޺U;7-j /}lhڕw?zջ%C 7 -imVtoG|O|AkSr@k>e:mngNd=6^ᅲ"Z R23eomm0F =0.ƝJbQ .;hkhVnlj#bGVЉP7JкR 6& ^h̘V(v`ѻWК֠Ƨ|;U}Vʓ eS-.45);Ӏ"+l SLdᄗ{kźwS&3h+ E=d$AIa fz Bk;кe'06dk7LUC4 bLw"v&Rd% kOAށƺ\Fhʃ-Q!3XnDk#/Fb4JhӘfA!L'[*ɴZA=o{l NpB؈_P` Ŵ zѵ 59U:V3IMGƆ"z5v9Zf.iY5wm(䀙iLm5G&ΜEb?g~:?E_q&/ݙLU_Ʈ3Ei4@儝YlsMpIPdvݙ#;YZ/`9sܠu3Z|n{fKٹ  &3"К"ߍ@ ZG?xW_zb϶e6.~n=ۖr߳>3g7Xjo߾mŧV> C^qoZ}U >ݽ/ȁFF:ơ<56*GuruKwynU/r_hi!qF{U \ -E".) 0X0/S@רܗ:U\]wea-,EB8BUM̊ae]2 q0Kޕa]Y=7zS={`*ʣPB]At~DXW5J Y TKkk&vҀ\/DDqi?eb{7DѴ&S(:Y7HU ƙI ];v~IKgyG3c&mK{@iQ7x+ F'{5bؕCW]j 1D(l/u9MgN9n^Gf[8, N$̤l2GAZ_<øJz޼[ǟofЗP!?3gF#<8ntMyPo"ǎ=yMuߠϝ;>coyޗwo|sxc>偍ݵ۷=u==.ܲ曛V/ڼz;׭н;mwkу^;{;xXg|56vXx{mV+oʬ:E;/)ȖJJ[v;:QtlѪmt)<.2Stu޶Y EXIRݖ-ڦDpMti=DU7Yr>U%Yir,Wڂ_/1vuYvč #+) "YR 9`Ofn]<5ҫPFǪsigʨڇˆ&DL l ɣ* N4z+-se`zd9UX55CcjT%Rqx7rnE|r]#vJ* 齼D#;PFy%(te0iSy/Jo/{x2ɀY˸ĹD8MթRIc39Af"dh_SB}"E{p^oQ,̆[?E'q۳gϊ+NzdT*szeۺNLr:$~Ӹ2c1<11L\^T$^~B;E[Ut Ǒ3 Ǐz!4.<s׮ʕ+N;Eems/Kx_ [{[Gܾҙv}uL[}ڋVz݅z===>~7_?pa.Y,@yݟ~6\P@hTCh y u4Ia2E3Z m bh;$ hM: ?! Ak)];<ijKch3R1 FG1 F\tZTm\Sx2f9ft$GMJ+t̹pIIo q)uZf8n);cMMyQt<.еxvbJK^UhGAeT>uELRtƙtkF^!e {VQHSyYm8*dZN-#j)J* sKx#}堏*`{/A -)13I̽,!;Zs @ll_MFD"3RwvQ8}$#y~G6>WVne\tSmy/UVd CЌ+G)J| *($v瓇q1X%C VJc|m0ZZ[skӁܑY k*X?StO?tjj۷o?vgnyw v_ض.OǙuI|=3}'hENYƯt2 ggz/+xuCgA:gA*ISS VdڛFX+$7I O`,*u*[u0Fz2aa .Y3{q6LOD^<ȔӰYao{nPAn\kMK_?TKH+ͰY~tش2$ MZ҈dVmdIjtyZ tuM(| :\=@FYi"Yڦ೎n5 TLbE8}#E 1Yp#&ʂsܘj]/!޳Vꈳ YP1tKc)L;|NĦ}@Z#X}7u TWa]%m\VYXBr5Q%eB W ~rMecjBz˖K^Z7Hc+e 5_4u.fR T+8!4&AˡTmqaABO:K0.f@x;g&>r):ѣG;wlfi%r?h۝m'''zSmㆯgrCu)ZNL!zYr>ze"|.,lC'FvⴜCS|/E:^fod |{}ؖ>|mkWןݻk&w]˟}tL_yYwɝ7_tǍw뿿3O-|_{69gGF}Oۿ[=o?6vgO:}b…>prT:WgLZl*Z͆" mNVT"4k0'Lm l7FТi#>MR"D #m0X= Q` {: :6$R76o9't'3mєY.umb!hfsf%Y$:a`z9-rSL 4j7!?-޳\GeLğmܰᮻ~aGG6>6ss=ϳumZj5|-Tͨ偏 aPrG'rs<۞xDѽܳ}۶iL&BÃg>D)Hl8e;ԗ"$ EX |]y R) r"YFqʞq!)UTOWݝ#w'|al~?yŕ]w?t`׃{\󉵻6?xp7o:9vϜS/NONVg*͙JR3 P]Ik:B VJ(7U@ L-8Xc.jNFԪ%FI49nb lS\ܲqQעVN*ӓNC{b~6_'?vw\m = P {ް#8&%da=~[w^e&8D"q#d`ihJ߫~}ot^綍M;{bt#?xmypu#O߳WuثGNƉO7ߛf/?5ո fSZզFcЯZoLnLKJWOޑ\=5vN s uu3Rvj.WukKk5 zh.SuGFF8.pJyKhyIV+/Zʐ̂>?-jEEɉ"xlaCd#I,~yї>uwO잸gƻ۹-ߺL[۶?r{^zG^;v؉׏> ~\u Z7:ͦFHhS]}klv2jN ^{ keuᲠ҉v։r +kR'.-lTnk{K΁Eku{>y]z%D ,جtBT,K;Ma\h ?|4$DlS_έ*$R+ڋ߬9_Y"kAST =: hWjdT=PvM7}A ]$AP݂@tٕ+Wٹu_<"nHp5/9/ Bχ?D70>0%,#@` =B|,Q/ުo[}Ti+rWRPD̲te״f}SЫۇu5ILϕeH4!J<+򝼾5Vr9~3'cKZ5d[5LEz%K_#DH-0}nPuaڭ}Yu!mӖn76Iho\L9uu dxUlB9n.])x_>R-%(˴^,KAu,8[]8j}Ö ˴OEEE#(zd Fԝ_@n.!8t5fWE~{?~/zi?wle ufuM;ml4?xwfNyг/};{zv{w>t|`=Gn]eMoߺa=Ç~}+O{g[ϝ}g6iڍB͹fcѸ̒,aéF-N\ _΍&*7BqgPĤ$*2-ˡxMq2<v*)|&BoI/]mL;toؓ\O׌Vq5ƅ`e,E]u-| `_XvN%2W2l'Nj-ibK-NOO/\z]~VqqMdAM-P>H).𲍃 BQhHKJOG$4IQ3}ܹHYj*eM4 7c](;,|4s~g߲@Ld 8E=~ϑ\wրS[U_ E=VOom[(MMO `~ R+IRk7,xP}O{?>1#݇{6|nmvwܒѺyw8߾qsW.|ɇ7nGou.JREh1Y1tFp:k x aX*r1|3"d0p d"ux"@L(c 3<='|fv!O M$kQqc TЎae@JA{;q\C"L@S^@-\H2*Н"+*p&EUQ s]U25YT\|96yVUYI0 vC s3 ZOOG̋- ,\m0j6,N( "'6Cd$  `bqŊ.ߴ3**p$TIA[SP؈52C!U姆Np8Tr.Ef֪Vu iu ˭V*6 ?s]KTౌz Y&I 2uNE:R4eTmp8B*P9p/D f$I11wm^0Rtc$Z+,uey5CB&{F0?='8nD6z"_]7z69[1 cƣs Ys]77סG#ooQww}<3ø ZnDn<`##}Fi__}%}{URe~;Γ~juGzچvyaGmk۵oKޮ}[{:[v5liֻ}O|ܙ];_t֭;´W,OzӥԔ?]-fU(HRB BY,pN2gZZpLs&|h9~Y # K#_  VsbO׿s/{ kZz67޼Wͽ[[{;|k8ws/_ztlr|ޝ;ݻAfR)<ðf ^x)aX!D)1iS^%"BB,Q[@y@ ryDZvL2 &IǮ۪x4&VAH=-m"qzlHEPI\XƧV(E#u!2Ub6)|R0OKf6 '>lpO)nՎۖeգìgb`l1Y̫IcKG\gE]K.]zuyL'Ÿ J=q+o|tM?◝A𑒩2s=BaUk끁ZPV"'c0"7XŠQZHa)Xtk$۩$6YZ0|y*6g`#3XKV\A;; F`joh!|kN?H,$L ?!Ee^~: Y*U &6$@ `BIHpA@*y(%4Ik}9E)& ,XvEC,*uQ(TGGWsa1-sit\T '1#[9P9Dfqu~jS.R~sob~ld}H4l*MsK LIBc /YatN&y ę{]?űJ°} ^i9<о'_]{G?û.k)~?1HbV8'rLv!jMzḤg/^esǕ4?%yB/||^|A֖L\q]%t8*zpⱟj!K,U _j_D!2hSbliHOJ ZȰ '6qr:MW_i$ybY&w5{uqQ\OϦH:eFn#$#\f'׸,7(*dJhĄx~,,J|D^>Y *|:6QzhR0u \R;س9mn ??*"C7}^翷P/߿\z[Z掣hQ*Z8ѹ@{[o\51OVlj+\Q)4u:г^udv=ʞ<}}+{<ʾGzZٵ-~bזݝvo_o籣G~7>9; Ώ]4^(U&''j"#XtF+5VkTqQ5.y4!t-u5s5Wy EiH[T3>7T{q]PMF] [&$:d&hwBT 1оW4d*[`mzխ F6Bhjt] +]pZO[7mLq>yw|Fh83 )iԱ̇}p~:uw@[[.i&:1k-ZtWC3֩Ec.=qi,CCfsȫ˖~ad*4/*KAD—ݻ L .޷HOjVQt=srUU[p)l9Co$ fyb@MCdm=Ô235]] G |uSǎmjfh=o ˋ1 "Wa^9 qo$~^zg+۲bjݷwָmcu{/n\޲~Iśk*Z4=~i˯^hZWݾyoıs{{/]tmPndύ9|$cs#dR1XBZëV2b\1O /L 9ɀt, ,YŠ5+!j (:S4 r ru"d&RJHp aN8wŋS?*6*ZS4+G<12qQ!vIl`0фڔ\]oԄwx&7?nX!rÕ9}4J(bl~x̟R@eW_[ZëX~Fhxo :5+*Nu͚Xr.1% jKJyJdqlȒ;sD㘪R8:%Ӫtƙ~D'pNbH[ (*خTQ:pq"dA")cѝLQF@Y6pD[8%i yD;Dq8^rEPa0%] FByBpH~[ ipgh_uCV ,jW3M[<-1hrI5}JG8 5mmX;d5(嚉e~_1o\˫|eӛ@k T&! Eax* o,7tsxZg=o+.\{ݭknݱ;w>gӾlް湖ڟ>TW5+O5[a7>|ıݟ~˗{n\>p#FFIsp?#pq ].O1FUPDp8A8$$45KtogDAAZVc +BY(0!2ehw-z c|,Q,:hQKZDqa>ňsr\Eڀt𶎊RJdT»J)hwǎXuR(f(4pVؒuĠKFޞ3Y= BuGtwgOϞG%b-ZTYY\A)Ο??{boOKHYԼؕ9 F5L- B,"14 %ɸ賤 |NN''Q{(4`o /xH41Lp8PaWl&JA8:!P7u.}k8V),3  LP0~X ɰF468N[EFP,&Xp5NF(|Z2Zr,#XCL*_t)zSFٳg?~߷?ϬOSHkqrr<+ʾBKCev{'MYK\Q.Dܖ[2{޽{>'Ӕ̡sӄnQG߽[вjji6iڵf͚u2ZceE?˷au_0sWWÇQ39ywՠes|ӛTi߃9S?_/bȸ q 7;l_K/ڴbOK]_h|} n{u{k͖ז-m_\ӦڊgV/ѪZꗼѰmΎ=xkw͑C~ugOxի1:2,K?B.C?k!")$*K+*"r(# Eh4X񀔫x,D ͊d NF%ƐN  χá H/l#D Hp 2}$HQ%2(ʲU!#7f] mҲEOJ<K&?دب3,"uE(*cKm5. l):!XihJl@Elxf{ι;3]T%RPe,Ȧ\Q*Rqk jtw<C.JyC$?6c{nb}!PyeGXrHP b H2xTۢE֕b,TFS'B Ȅ!Ƒx!I':98ؼ燇is P_V);PّbϱP|$d,>PV8 L> | Aqn2'2"RәD0*M!~Ȗ3eb V.EmqHܖ@9˝,qO]±%8f<{RXϺgMܚ9vrh8P{8G{ }թDy{Kme~^L7l^+uTm;ݟkkڳkWcdC_jo<|ű>{39l[re9eۖ8̱]y-tqDajfP8Nȁj)<@u$H,y%h;P_!44sD/ jQ^L9X})H,$2;nq,r'ª ΰ< YR¥l2*4.yzp6EqE }z*7U[;v@fMaaj*$&X:SŋoXskJkxk˗/Nԇ5柌b۷o `p+.׮\@mHt)j]t$#=-=lG%Mak'zL(4)"!|?В؏B-:-׉ ^4,((K#pח6HD@k[VRJC[nf%^EKj<|Z=J\Wt4/wqo/ML{!zqNmfW_}?Y?Z3`9Z U<גn?Ş{ٻ7Μ>4S|xo@:xS^O%7Vʮڟ[~eZqm[궦ʞ=ot5[ٲ"YvU{J5EN}yݺ1fߛYiY)VSZPN@c|k":#*Hh (cyEN.H sD!)/HB\"BpQ*a+"6e9,wY֥HyU%` ]&$c1:$ޔ3J6:')"0O*ƳHPT]kJ)OKtH1׍3v$?`]`l (-+:;K ڇl ᡋ==?\`eE^<4.&dQAz:8z!ǃN|[f>{v0[\*'PE&{દ&z%X0oDMg$2-t)+ >x+:ҘOe j[XlXJ ZB j\0@N4%0;pvcw"-hcGNMpx%^[CA`" #Q VR³0$E󅷱 NO#fQ)D4/9M !%h8G;ta $5ȃ1}Px:d;Z])7իWg3;3efi}u*7o޼ *''' {9er% ZrвP( ?MKlYz=-KTJq [bhy{P_hO[99i Y*N1C#VUyЅ.pkjX; /)޶>c>Vy,c5K|xsv=|_[ȾUO7::,۵y²M6ȼ[Vvw'?xgZyV.0h*aX k4KŹ5̂taD2Qi|cNQPM6tc s*TMY+-qH2hqKNYzhn56ncVCMtR&B=fJRw*LЃP1SEFxmuÈ,i!7p>V PT-Z$/X h ȡ\Yqxc^2t̵ДϗE4cΝnQ'9:rqڵO67{'Dk g>8,) 1Kpe&b?[u#"dd5AcO)h蘠DLv N[ TӅYV&Ba']F&)SHa@/ =.JҩU!N?C5z68Zq16/LpP\:2K[<9Ha@MGԲh3͘tlq =g g23LIf]V^ittq`p-Ӻ/|re8رcKOOĝ$%kʮMojCtYf?H˦Mg%-Ь}Z{օ‚Od=SfFWkzz6&&|]oce+W~q[M&mtLNʠj5'BUZԬS+:լl)"eRx?u}{Y߿gޝ_\LZ}w/Ά\7.|U|Ů{[r]ۖvlu koMy?ܺ!JB4R.W˥`*eT T(\h2LXM`]D +X*>d^2IHH1g`tbXE*hQYE= KdjK=b4i e-,&zJuh(+> `@PFJ 6"YfSPYd,>h /r7@߾{m޻`12lj̧|ůܑ~V*^$BT?CϟĉBL5ld⛯y0-m-~RTG-rDꑁ$=SE̹7^ؘij?24? вMI^V#򄈄Y8@&v]PY=J]8Zdr8P-kJZ UUrjJAdzE d5.(+aFxx]3$`Y.F _%AD ǃq5ro 5.!0Se8x4 (,j(H#XQB@4g8ԭDM/i=]Ώpfi +7n !6,JSB2{9S-orh_ۏqhR+HV*UW\YRNLM1](i{sww /5 o7=@Kboy9v i}9MZYtf=א(N7|uQ_n_xpG#Qtx8pu%~F'G-qٲo/>n]VڠNHalY54z^5jN#nD]>jf[Qc6i5f3muڌLnk!J$F֦@=PQ급;̂0-03"^r.u#3q-ѵMJ*utqa5͂S(k㒻Bi]N~&>[@+Z%A! ꃦbKN+fR"Fȡ[ZhÍ!be/xfc#S^9F͂AX^̵xĞɽg~yC>p}|ؖ-;:{֒1;79gb|=㻏>|cBNRhAf_;oľ{9LPsӧIp `%Wh$Y`@[mp+:KmĊqq%/H= m H],q-OQ"f"Uғ-ھy!Qrae.YttlRXL6rxcf#Y2'LV\Ru34gǸ\g5Bnafi{33vxD|U^8U=QDS3TA /]anտUj^+Z/pB+V||||EU8n]}ͥKrO~6+ K_|&7K'H_Gܾ\Ag>M#|r~EȑoXu-Snqu3?ʌY4ri;UPg Rie6Fk(glv7~s?;-kl]1mO/زgw ݽn=ϟ|b퓫nyŏ\[w -jmC+vh'ɑEn kDlxY6]cKò,SUIzN-Ǟfrj["E@YJ\C{.]`%iEA'%)U}E\#w6wTil{K/??qߘIQtԺ3<9hэO"B:Bk5λc\?>@[g wž:8VDWAEHc )MjO~k^~nw߰G{xޑ;Zcpֵߴz5]O5amvh̛3m5fh6>ql#*mISQP QK5)t^u:2'A!ʠ{Au,-w1vRA4UH*u Q^p]gJsம҈ uP9˃}/Gڐ`fR-Q3j< Fe"`%f)KQ)TVi@i F5cM8 P0 (fn,̔=DBZJ貮fk 8{Yd؃ne?2 Kh "y9L=|6vTn277_-eiMU~"+jEٖ[,5-ܶ ?ۖԷ-t:m6zo.s၉~ΥɫoIMMZ[֔?*zi驝;oٿMMkqLӆ gjVWO޿D`ň٤uQ8hjDVCeT @NG8I #q]j4&b3dZG3ϻz~s/ٟ:>s~x/wܿ{滷|kOg_}ܟ9…^nMS`@1XPJ.Svp ΕZeQCY&r| Zr-F}$b`4AĄhċp2}A,VZ7\(yOsdC/W6Mxi]@eޏk?<̯Z!~D(EףY`֊V"+2]t/IAxd:]X]C}F=MiH*uz`A,֊#Z|i#I3i !iec0uъvx1mmr d녯`U3оK)(+X-*&ʷl,&Fo=?E?!9y-[>A'N][C{\̇\2Sض3".K_p JJU(+XUXEmW` &t3Lī`{4Xłӧ~wGq[{#}O<'ӯo:߿%$ (KW*5j`xZֈ iQV`xd L0Y2ᜂtFh9"w+А^`t#ddqTC8ą䕼YY}v hYP$,̳ZR/ȫ2٤2|"54vf؇Y s$ZJk9ȇM늎*ivfj"O#t"ayT/X N @`;ƞua"d :J:B:t))9d-mhY4֙{WZyiERמH%qX892xrN WaƏۥ>atd}7]ti1%kO`YI3}Hzc ;w5eR .J:Úd,rC`"hm0ZEtԬ6]DIhƲ#^;`nE7xY]] ?yt:֐3gl߾jfgg?JuF$hrigֳ?5_m׿5h.-=*zna}m scÇA5DhmX\Me[3'7jy=eaTWBҩ~ErEeU4v'WM)DP^h uQГN @E ~4^9sWOv Oy딝{ o .^{+NYv/1JRRDm5fˡ'ۨa00. *%Y(/ M1M÷CQ&^WioL&?f(*Ѳ%P.DYC`/+3\(=wDzbo.B[M. Nv A8Z>MQp.;C~ q$/pNī2:'5z1Sfv evsEa+W O"v䔍5c4Û@?rLWR!a8"O fAfh\`T"RqD䠒z]G'0h"B+?9}^3.fϴ6T2Ɏ+` 6HGLm!׶^10 (8Z;_;5 @qxg#ܒڠdqRz(AlٲkpI붴KAiY콝  8Ζ ֑ooD9w֭[7iݔ֨ǾzUtSs3M f޳g~,hk037m^}yyqǗO{ p;wB͑#wnzc?wq"؞UEPʩҔ]Be7ZDcK+ʨ>}-A plv6kӯJXu_+$qb`hp$Hpt,@Q)$,[&Yvg_zkX6A3Apjg4#UVT׫w>%t J]ݮpx}Rx:~C=g l$Dtp206 hi#ͫ$cU>J.5j~aQTÏrUG7@$aݸef 5=Դ/6Z/Eg[Qt~M~%#d5kk2Bt&Ȧ4JƄ!"ֿq4aDzcts'lII$qX=#)>k D"g!vhVm;h`mfme\Y r)Tv2s/BNZ Mp1A[dl5N vrޢ+|dlϟ, QI: }s%"*F*5'OC!gcgp8#բz:dAԱSՐ0pv3`8̅)<ڳ 59<3)x!6ӿ^f'''/f^z镣Ÿ|~///~g[5{}pMVn [*?~L۟Zn<^.Zn*ZmyC˟[ |[&{(̂ [h t?W(׭g5({oyMMaM7n5|۷o95o}rC-!13ۉ; ҁ.Hz~0g-ZE}Qpˌad[6XN JwS-Ck8UUwXphnԝe$8*0Q>.aPj@nY` JmPلn uWt'#Gp1]H3x?#ٴ, Eҽa9.!cMd4Vi-p,9TY!ZPxZId[X aaC,KEqU 3k->j0Ң"Wݫ">u+x/ wyj*_}_<޽{~kZZwy <8MȇKK-'EKkIInC–^!tp֭Zo尹(0;?bj}?2PzO@ (wKSo~nh}Zvz":p4ia%荩j*(7tJ@8\5F3N[b:LS2M+sz'b0cȨ);#UFc jb ^c쎆=n,`>AAPj3KGE  !Jo* n'k8Ż5#X>a"UtoN51E aU{>'ca=iC`~?G0CVƓ&^YZe1G44B+xVhSK=k-hYa%FJ%Z1h]Pׁ4Y\bI=Q-vUbhѥ}T$yYjǃA) j_+yl+í sWj2h H`35:JWXB+W$owqq8tv) N5-c- oE?7;mV9i}:e |ʶo:=Ac^l5Oyr~z\qgS [^cR -[8 @$EPw€@ 2/~-UׄL6/M_fY3+IÚbu֘Ju𢤥yUpnY_LX$ ✱d#@uUbUBhc+#d- ˜8k͵ `a?]*Bl&,6&M l6&!MH3{Ka'+",6b [7#8=.̝3g~f9 BB2:5l&$B>x/ mL獅 ޷㶝0immnm#|z(U6͎|RLilzHVC,՝ŔÀz*~׎T.׷oS;F{sww֯sh,vzw^t|E' Çϫ-O|ʘzo 8{Fc) Lž~St A?zMz]{;wvv>|HË n+.-=zIn瞴=sy˥с޿}޾gOT Cn棣_3}~o|x~;췴wWϳޣeZ ϳgW'f/Bd ]GZqD/Mw!Ƒ$&9pd`? 0)zh @wuC՛"1 `69lJJ\43\ XPl)'| W)-ZAwX%A00v#%_qyB)ʔiAa M /bKiG2I|2k:L~`z~Q}Fkp뙾^vF2Dkz.R4 ah y|[lTJs1ST L׬gϛ)PVJ8:BŮ*j!v-85lq&XJ1qOVe[3EAQ!ĦJ͖*x]{=˪P۞L@T;NYcVmhV% db5$] iPĵ:heY1hH'`"b! LOeG^[ZUX:Rqasr&dhd xvoTjJE%m舭~_RNVꩥ(<>ꀕu_?>?E?>>~ݻDZ΃DZ3٧Or zѬz.h췿nG'sOp;}裏K3www>::\pK%<88+\ZoA}?Gw_-yw'aoۿtE-O|gg-_~sZxW{}MiDPYv|o EJ5b`a36ꤑ:o>I A5- ✸ѯ67Eu j4u&DKw4JpQo'Ѹp"o̜Q_9<7ʜՄZZբD3;ga ohGAdc1na |$UD*KFx~QԸ-/_|6^,lsCVm}^vsɠyԩ7nA=;~u@f.^3g~[/xIPdvl-ϟ?~8M ks߻{wЯ==YͥK?|ys2_|4)zP7ϟ~{"ZvGLrkenpuҋs(6U݌}@VYf,] -Mn#&ʶ$ǀpKʵ|V\ƙ] (Z0ꐿA'Kz˓S [OqjP YΉvdր|փ q=(\(AvNZ5@U|Z%.KXEQtŹ]GHB%s(,fNGl`nB!}B`&iR*4[0V᳢෠LʦuTP3#|e\m 6lq~X Lxl:VAv c]c+\s_3Xexu#zn[Ȭ(X##J%TYl8EJ7)WR$%청d&X()"̟É 2*X:ݻna% ,I#Eo'mT7Ei+cN#H8215ʙɿ5YXL# %g>iR-'ϑ2%oZk1Vy[__ѫyiq•+WܹS1o߾~d[np.]9^2Ŀ׋^w![2mZNK8BZ'k5}3\ gEAћ?L7~0E>7!2} ECw"t~0rk'>DZEN$BL~RK~uxvߎ k\+-zQ niΪ̲%o ۺvTc @魑mZMvt/FfۡwiZmtp}j%.c?ȉɴ i5IL̮Ͱ*E0O/FBXFC9`VNS#T FzTTmr'z奚5(Ud`dCkޭsBh]4Ƶ`!'9<0Y$Ru @snRb^h-5`ZᄂJnIV9_'iykvaKd(\$"PJ  IBqR(A<-TXe T(GSJ!gԊ%^%!9 +7z*gFZ eY(\ 9gE]tr;+ū:B)(K"aPڗFKD- ﳔ x/'.Æ(`rz ߎXle!]j=B&{5$Bkrt럏_+{K}oe>?~I'3LT8Of[y>ZңzM3 4=^ӻy-)hy…ZϫCk`z'_ܻ~gsm'rK駿ޟ9'?GѴ"|[[?<^O<]%n鲈ͦy'cYI5bc093zŎxB iTT[ ib u CTt*"! -eޙ~ݠb "n )T$3ep̜9s^sVoڒ8c%K(BSHcdpy@nq*%Ƣjl=NѶq ǏْnMyܘ-;lNE YLG|}׳g{n_j ZoM]7o#Mڎ+Y"(gQB"I*6ww&T!L{eݬw+iJ܄In}q$5Kq?/}e7N -%u)R""~Kjqd(CM}}__;{_kZ}(VaY_G*i8{͖L.*7n\zVZ}ǫ)ggYQf=8h\jm5״'`C ö*՛K#wkG+!\+,f8!ucv\ݭޞ| ݜ0P0 8$&Ev$">5#ɴUp/ Dh'4e(ٷ"jىjru >#%؛鄮jQ})*= HB&3fbM]raڬGMѳ):d!Qihe 0 'uv}'yN :*D64݊d02˲2Jt9qx@t~99 z)mH4 ]yd #Cޒ]ƨE.dOv"A%euw*M-ٍ_K(5ġ)G{:B4b1eDDXbgBM.DhPS;@ (zkCˬmPX3m(F_=.Tܨ"E7#B&AF  pNcqC4)˳<[ES D(0aXgv?}Y'dJOV-cV!#:gv˼))%tڰmK%8Q 1l!mF( 鉲k~?~CO?9?EVo~>|էs~:2ٌ{ 珯2'}Iŷzks3z+WZᆥ]3|{ҹY .\9u+3_|QO7-wr\7u%B¯e{}7~ٴ09϶n?O;f">?(~U˰8tz`)}_UK}?/7-&;L 껥NKZa4,0)p/h`dBkA0HRtm^KpO@ʲfZh&"!Mu++H影|[lcZrL*m+zgfC8_@5+9HIbP:$$2C d"Dp2X lBJR!yBX_iW@nlsq29%f eg焥 F e`]ф0%ѫ3W &nArvSVV_e-k=j˶HqljdѾsV!N^X&:*Ms\A}] =uCCޟ?} '+_sVc޽{!'pf|ѢAf9lyܓ+'훞_4 oznƼr~~񥔚楧s) ;uN̛*fElZ-Fрޜps os1+|N-b/.=hlL(֤ҧ4Q6VCmW{#6W3r]LntH؉ WЯ%O2H۰WgZB.9aW+$/9a(q}Y\kZFU(d`!|%}11.OY{35O e"_*Sȫ, ?{G'*dG&W?Į1fF-u9Ex̖L$AOnȪxr .cKΏ<~s=p)>H?8MQ#m3 ^_xʓ5FCR(WD +*FtmI_z.B8Ku챕v'+VrD3k>WF#k읪 ,|'0C&`lК9'*t /'&̶4މ:3=bIdhgLJF Ď۹W8}{W5z9u)x{A9NҡfÂ} _xl$bqڵgyŋqg}… GGGOi}VO[)́|2w[ᆏ4=(=o޼y>8OQ$9U6w _ľyx `e{0x˵k4޻<[@=|w_\ozg[b/u;:GyzA:XK;tjbQ׃`" ]Z?hiF=jbxzx!Ҡ>:~MaҘSz#ZS ȑgJ̡#ֵ06YϨNfCHp vbXY&grTC_2H1Ǚ z]hGfA]o6}Xjm5l,)AbS;#acZVz"h^'9xvZK.P-نU2^`0Zc7p8 ؜]wsp1XE/Fo6X8kQIZdu+'AhM]ĊG2u);౵+#Lئv')3$ZHzBX#:uk )J攁L$* cd 4(gδꆍkӮWM g9D|#Zġ(YdcH0h")=/_>9?E%sh}=T?dVO֛2v+saثWrOvyt;;;GyrNLK}mk9(W/7[˿د{׺3I…!f  *V[vkL`,,Җ{ϙ&@R* .T$-Pv0Ν;g9sσ8f>><-l[59Wi?ǟEpx(W=O}a]L$mM}VnZƎvz ?wϊ^=Aݪ"Tୁ .H!|w{Pc78:wXVfu=:x|t8j]ENp N*%ʱ#%۪h*pRErVzJqPy<7suC6cvaҳ̮D[d>3c*+«-!R]TRb\gഐMu xJ 2y֗vl+V ]XUǀ7x֡wWb4lI'S{:ćA`a/z[WٹmxT򅽽J(hj!!p 918]R Py:u;k0N)u:մA4$jto\F,jI=VJh'Y$" md6Gp8Kn b[m Jaϰ&Bqmi8?vֽ2[oy)qǏc5wϰ/_-kևFMNlOD㝞@Ov派V 7L=S-F =[vpA@˗M|di_''af>B-o_Gmo|ݶ\?O^ ɂ%mZli8y _KC;w>n{R?;=O/_>CZji{ >rGϰv\¿.hFO>˗_13Bs~_~s|ukYG ޶k׮pFN =S9eIlBZ КΏ&9'V?3 =VxxxHtqIyiƍgH+Zx7oѣG>Wիw7Q.]tAVYc|@۷6W7pE˷n}gOkal~m #ܾ}9rW.h}?FZr]=>*Ynϩ}U:( ZP0@D4bL6`ՕǮZ J,Ab/`8&8QY0V\g,҅3H8<^,-IdIc IX K102UKV返 A`cߥQs r#cnpN7ESA:PsO:V=K'$L#)ƞr\4͐aWBfg [ïvϪ(1څl̋D`~b;ii}R :AZT*t{5P _~˻w,Fa/\pFVӺ)n~'?!go"vKm6c&a}PǼ -h}߾ݸe(:n4hvӰ 3(bn&|7OIa}rk]UO&oVqX3{|[#LH |:]ޭzAAB}#Nԑ* 'B,@ \Qxdl?R\ ,Qnd'3O]p|fyƓK!:%PGs!7a9Rl]1$Ke 3 Ȋì)cW6]x.f>IG5O[Pԉ`VB(e/B})C <-KVL|08*IvuI5 fٳ`'O2|vl$ڞ),PRk Ip>ag떅hwu5ZגG=L1Lj:UN>N.㊫ u~:Pd 0u Sz0z~JTʃHaJgC@nq0z[ o_ھɺ2X>Ƀd\Lu<tٳ{]r0|UU.]uփ?~Zc;AZomm&b+*="nki-iIn7-oZ6-7},]K#*͛/^ [jZr6N֯Q^*=c~~翣>3(ܽSim8_`~<_ڵ|~hD=-,?`LP"K&M*OZ,VUz ULB^BASFҐ|q|J`,f1X83iWnD椳- gz|JThp?7~XaIr"3Β+3_9 v`TIX&qK| z ʰBglvVkM ;9- \W9 OńS8g>bWV@v5iZХgkaxw`i,C9O6c`a)~6veI0Is9cZb]Qs5]EvM=̯S7_tDg\}ƍ7\p |uOS5Tl&E)m&ZI}Ӓ6nZ?4vrR-wjB縗۷B[*|-/_LrFo&owvxi8BFo"(n,Q4Wqߟ~_ ]EF@ۉ#uAk-Fq֭)nU4xCn}k9IJ+ (zJan(nZ籠`ii.KZv;ޫ1 # Ch$6钂`F BDnHelD8 &):O Y :SZfTx c Cu]F_\sVEk9'' mH&d/ji'X8Ѓ\*V%>>A m Y^y,J"swtdR_._Vk`*"~NV2}uB\4ҿaS*A"dE\ϒE!S6Y ˼LP4: lSh0j`Up֖E+$$().d @  L]kk;NI=jK?y2.ꀱ@ ιs]M["@k -?,R +m:9[wYga~qdҜ40_Gu\:d ,޹s~_n "+ GxjS`ָb6Mv֒OꛖvӒe{`rҺ;}߿R dh~Zw>W_ }f7nCŋ/~uqo#*)"PZT.\%B[2H8"QL$DZ"Rȁ<{c3Jt)S7Y-"Hh%kGGWܙ93a+.^| C9pˏAGg8?oQ/~6 JϢuSE6@C`JvݠQF7LGG :]~UۀMTIf- {NnGѭBqEe4zC)sY=4ҏ\h3Ur %ob'i1$/wqyRv?E0q@LB],t ʿP_ G٫Lf=$o !>8iʵstz ybbaS +0D60ST/cYIANzXG\撡@8 YIAkUՐBu]6*[z[޹&Ep ע^2:;"u"W/II!0ͤ4[GzI*v,LU@QݑXsvd2!P)W8ASgU|xJb5qr'&IOIۨa=>[KYXgJ*5eU8]LD=b>L )y4D/%vO弯ρE^|?g!kʄq+?ާNgno>_R;BZzs%ϹOۓ/ޓI'8yyX ??+r+W'BB0!O ݾuK!ٶ&vT#HM4|7.^^o7za18pަ&A,k|vo0mR]E&{Ui%lG.ꠃQX+Q@o!0QMD͐VK,$9 ϘA+bg'l#*W@!/-תgO^1o]|W`jv;&#kaZc3͘C(TQ=Iyay,Uuɨ7R:𓫙>KLEca3 s [: SMQ eY㭪j+>;k}0"u]hе¶Ցl]Y[R:5NveS!IRN*hӪq Oz~LuI56MI¬ UJ뜱+*`-JC *=jI#kf$L:/X3AV*¼\'O6ZϪêOO@Dy)X0ӭ˜d_n݃ 8={͛ڵk/—S!?'|ams]{oW]=y{ӧֿm*7L#p/kㆷ|y̙hl\H_I7y7~v\@ѻ9F`~Bm`q? lbe>._ww~]gy/ ~2Mn|hA; G'k8qfj '~0 %7yփ^Yo>.8ЎLcUjf3h*$((zz5%ydz-2ɱvś1;$,r<fVe's;u)|s܌َ1UjXT`Ko.%f;T3w 9GY⭖إ&q=ESA[Q\XiW/Z6aY+ ʁUT%+k8;6K>rz{НkD8VNENBصop֍ktb.]g l#1z+{W_2eCH}y[ <0mÁ6uZtFEaԪe8S֩:'fx#S kbS|U=eOsd}JսeF虓%X*T]꣬0a&8GAsfP8M A=5rLLQ"?QgOb;Dq݃h|l;ZZ73}չ>~ UpWɣkǽ_pLm>= 9ZZ;Ƴw}Nh]?9,d."݋<}g_^/?]ܾK^8 h 33 mTWN̛{wW0caY?H[3cZO IFd%ז`dI>.6ڮ8n$mFgGEV0K))}|1-dFhR\E If^b0*e׭[YHI m D4Jc01q >G`9"A0!Z0,H( xc3tqHנ5K5EqH( bP~Ʋ.~ KI@g-sAtm: Y ;#:@5(л {cEm3aܺL s)Q\\`\Qҳ%5LQ,,,qqq~P>h+ٞBOԟs= {BtKHg[`wOT@Ƨ_.!%uX-*)&ں5 (–;;wHZnެq/-BK]]Yj||dtnCGzjJ*Yk.]qu$哃mWOTv|-V7nybu5xmG||r}ߺqgyO!)QSZ&nH)fdܥ*xMcl;ϹFtE#Ks=՜=6siQBլKI%*E'29ɤefd*[-SL.m"A,p56EPߎ4$(0r35]fs~E z0f='b#4Zc$}NsFArIyʑ9 ,5B,1x 7uAfDkM5i2S$Z19˔ 9ၞ[ݧuu;{Pӷ;w\=;qag{9BgW>i<W#٩ۉ둛UFߎ~fr{G#CR42fsg85xqi]8*\ %Vľtuh7IB|M.3-pqCCb<:s:~`/\orݱ)5q9ǥ}yƋv*O;ȆPG  !t>r6y" t0: Ft-cfqeѣ?̆aCz,-jTS T. ٠^SSST|= P߶mş$~Ek*!_{'ndxlK}=lYXۃ>h)(OjܿzO@kXq_)[YlUVoNob뵎滷SrrȤR)M"Az64=Mtgo1wT|Su%pB tzZC4@k\5jGz:f=hln?}i=ZtuiO[;O޸4xk&.G7CԘYjdnjPA, 6830up7и)0 Cln" mbySFzZKq ?=9=7}nbݙ;ٱy\ %h[KjSk@s#h9=2,3C挬ƅ괭l-f'leڑ,iIB»L:1+5Sq#YrFTtl(rkvNw7;xWM'*4T,978}Jj?^y蓷*V5l~fbڟ]So>߿XQrbE7[vǵ?yCz40FQEpܱ,X^ޫ4kFroct yK1Gޚk̹ϓw+:5.m4Su=An:X_l7p]NbQz(?¢`ED#I,@"A8HD ^E",a1쐮M黭{%,&uAf k,ӫ"Ց鶜ӆ³s={*nW ʟ::(/hIxw'J-4Rm ԍA5@k>1B ,~t9֝ O c'Ƣazi}} +#'Wʙl+Um=|S]]߻4>E׭s1M;&)1۟3;, K,cwٝ)|s?gcajn=J7j!m=J7h;VdZ_4bsx~ml{`\4 VS.BqF}/=å4.]"3GQMAэp*#ܠ gȚau'c9rë ݪEgykyTcl{Ɯ.yAږ)ޮK7'n͛VD%VZ1t g5&~ zfAC4P  1t-Ef3L( }?Ӱ8RC ,1EBWEh)-ˁvO_;AA " Dj,1؉B/eXSDx; RzóC9O3C0&_f "+: pBYYds$rqB#!Q ޽{2 HJSK0J88T 50 UB>T)]/-TZpi] U0`CS8WMouZSH^]m 3Cf2#>0EC2EA?Jv7DEpAG}'u.H!.{z492ԣ-)TKSkU7U[-Y Ɯds^J6PhʍFul:Τh̿`;g;o*3_MAW96л:3|ulppE.`3#0`1CG8 ?\x,ti]z^>pzd]McJ;XWpNaLLJf7憷ejύȏg2dp& \xK}gfSŮ:hgPڬ8A }.f|gI8b4楼"N|seeڪSLT*4 ?(c%d[gʵsUK E -t=s5VSF'wU,7OK%򡢄 wvf#%Cyʠ4dD2;.GK2]fxSFx# D+euauit8֐Vz*DewI2_/x;/(jŌU+%J\%%)k M K;7<+<d81UYQ4i< *3K틪GCF /}'{bgGsSPO]-I=PWѺAT}ː} EC# c= 4.`&E P,Cr~0K ji(?-^\EZ(qB{J@Q>c6,N헟 E333O89""";&)HPLLLְǏa B: h+BZ T G*Jȇ* =O2ZC+JoooKSX >\Z G}!Zkj( Ɩ S8V~d{~2EK (X^\&98XE"pjhE=,И]ʹa[ojh-nۤl׬MUR+t_gOiyeʘu5"I4+F DETSbL"51x#@tnU4ylmma߆Ծfʷ~o{p9RGIͅp4ɲZj\cAb3*-t5pˌ}mپ\s쬻wmױ Ǝvcp9Q8}ǻ oCאUƂ{qp>aTn5l =ȷuڸkAoNTPx=qisVx4#v%UJE)PoD|bxbk–DfR鱈,\&5'tC9T}<+rzj{Y* rn*7IkOfF)ӣѪ$5dEbhFZt#-6ޕkܨUiWjүEiWk"X-}cv% (=nʰ0}.oQ^6VVzkqomqq)n;}@e?Ľp|Nӄ]р h#=1ĥ g( WTbg?lP5= ъ &' 00v9t  ITr`PG=n8|  C0X4Cɸ#gOhξS #> 憩K@ I_;2"?~Gpb޽{wi}YXZ''0`dP.a6V0??֗_i0<{ 155zՐET!39)?H9| Ԅ|ƿ>iwln-.YƇJFn%3(OVN/UPYdtF*,/)/In(c&XIM,`E7]L/~ nidoixfq[CƢ{{^F6ݫ3{玩Vާ\^ToTQm`mZkb=mIiH{OyKͨ&ME[񼄬gY$#!/BFh*VIJ&I^@j_o.T5g7z+SL1'JsoRĩ/i/jř}>aP];^oԘs=-)ԨI5op>-ecQqdU0z:-_Q_;<,jcd-Iޟ昤huCvW>!:0JFs|l՞0Ӭp+*bkAuhU:UNKsQ-~na18mfvkesq]_WӦkN 0巺zA<*+A~Z]zf*zj$'.+B}v ;QGcQ9W+S\Te\ˍVТ$mIϊSwGӍ'}ӋqseƹW/~5G݁`H )J̏ z 'fB8< J{,1:\pa&硞i`9x@@gE s4P:cݰ1 nnVpx</*!EC B&> 4ڏqqC{w0ދ, arYO?]Oџ?o߾>|N+?GS"D\.###OC$J/>e$:aZ_a!ߏ@Op0~ +_-܅!~<j~ũ0~ @+/7ϟrn.W#n6]0r^)B:Ji1E]B$CU|oiKӚ (d9떂}[N&7efzM֖4՗x1PEX;KoC-[:p0:ik;'4W)Q@03 6b0CF&ځqhg8>]m[K,;$2mZ/ӕIA0(Mf6$ޖg)A4ZC;-LZ7G֙MW*~+0䜰)끜D%2Ѣzsgfdwujp"ۮ˱Z]Ɂ}ѓKJ^ ^C =9>^R%zA`$  ,g a^PfعSɟ,EkZ_ya9QI =-a X=$)ZrL]y0p XE ަ)(ßpÀap)ۓgH% ׹8Ss =]8vO)tq cPO~+׿K)_ >/pÇvss_IooVo+!`~]&i ?Pam9/`G^ T|^Zz!E⯴OkΛ7םAÇ_ʀy~JP4RvLN{{:vaJ3| !WLO,HDFHQU,mdAS_$/L(H'+ =vAbg~a4s6QZ[ArNx/\-7vW^mj;]U9XtJ 11^w8QxUcX$/7MyC,{;JώǍŪrC5 3BPUT*c˹rsp}ziG6^z:^nNMs+euƲd5.ٿ[@6#x+ iENl|jfaa7ql'6ωpu ;>œvy;c;vp\GVrb=2myi8c_Q˧c"mE$_2!ܐ.CƧwpCڹ!8BU bs5$+K4YŬce\5?45[X] CnTs.8q) q -'8~:%K8L}μ ~zI wSqǮ`S`%/ ŨG$zv0PJpGt 4{ނ(ZipFI>tR<֤CO]`/ԉE. t mEnpZB`.'zJǏ޽/B\9>/͛7|}/5,--|] YM@[>#0㥦|vv -$ѧW+ϯU? 9? c:P?nF|woY`lo-ONe39RnfA#QF(#^(L/I{,+S'LQj ֣ci)898\,cJM&&>+\nb?lf?l̢7q}Eq=8Cu攔=_W M꧈ҢZ#RD]?p}jxf ZI%_k:v-ܝ~j\I-3DâhX]at0Bڛ<л6$cݓC_gOMei qkFP Dv4(,a4a a D f{zN=3COW?؏|'jaʯNݺ˹YnΕޢ⨮݅}ZVŎ7ݘnNtKWqc4y^p~$Mnt_vT__0\o ypoǵ;vBnsh0#_81^L{1(/^ tC! "_9ߑXE D:Q#Q`)rC|"|.e:+yuasrFrwu@u󡮩z񾶱Xxo.GS}A\ǘ ;&L '!&HzD&K6\ Dˆqh XDRZd0y00$'23(ې Lj,oı>:,!AL !(K<4NpĀD`^ȉ%i%rj 8琗E|s~`/77XV1s4MS P'u$p8"p?77yx'q߾iHRprO?" y"3C33G2uuiWC}H~/2gZlVjcc~v8=6 //FqjRYb,V"=N!\.\W_UWiWhʋSގn_iʾyV[AZK~bkU坋Jٹ3 4g](Y_yk*G8PT鞪mu]v_rup\ik&[VX}EfjZ^QTV,wYɑ8 % Zd@t8g<ɓYO˳Lx8 2P9#,ס?Y2vG1aslPg(pFl$W&d#+7I]C>!?ӧ?:Z'&[Y5R_d޽ ?r$a#2ܸv91[(٬,.? 3O6~{ρm|n2{ J)ˑfVfV夔e%UȓY1yW[JRl+\۔_ǐjNL8BCڥygMQmQ@Km9ѪqwƨG*o;sWnh,j~mڦ-h9t͞\>5~kP,.M8Lc Sũ}Űjt7Lpu/o-͘ WK[5~pA1MCŁ'/ۍ'T5SZW^崺إ44N=xZ;Q5pYhzKRS7ө֕d$i3d:2ؖۙ7 :{}$?i &hQqj3e(;2>]ύnL%`!#x9I TL8 a%-SZKK kLaq@8 #:T $C"Ăc"Ry&'6)r!JCPi4](pp 8ڦ"Rqmcmg{ffxHZ)W8pldSU OOc??yL0L(suUji75MfLk.$TRWRF:lr>\0U,MUEKTJ̬jff6787%L| t p=tM".6*Iں$9u>^Y$ %&&G3ñ鑻ppɑၙCCsñ3c}3Cckx݃ {:E{;ףG.}z[=8t;}rqjvbjLKJTGZۖWIs8Up=Qʹvu"G=~9{ʑKqs I ^A^Q:% w}a&FVk8W%Vad1#C4 LLC3MW4I&wȁМeA_] Y6@1ǁ0B`ÐEcutNAO.cciЋ4O#:vޱ .FJHҘiL8@} Vp̢Ļe02Nsyn^,)K-9qlcx֭[O,ZeC~m iЀ2Q&@&1ar0Wܗ3L˙ჽkK 78Z |/hGճgBloo_[ZwGnڴia i;‘f{}JH>kHh]e3k{7ʑᖚ 4ոF76hG_2U2j2wڥӭMF^:=^:uPñZl{7;[p*zH]#[nmT7ͭMv#۫O醚3~ق޾{sGծ쫺ppۙ{KW{nkw)#Q}aNNYi;=k-L4K8"uUhix=y'`Uih9EfU|LO-3V&WD6dʳiNX'Ƴ<[KKؙ #)N".2)@d6MbhzzLK>77:$ Nfze-Cc=Z&n7 ])@k8^j'L,dy{,w}IWO=BE0!}!仈rn0ј,yftdKG ԁ}a]1:9R"HX%:&XAyCy6&Xa%Ä=iȢC}S*y^=wcE91+Wv̶8!- +\0 c}"Y$n;8Igb1႔%#Praj)#Cr-1_z?]HfpHO ;_اEYgV& mf&h<,lkH?^M>TV(@bnkny 7hM-<\"veeBC//_[[kWG_H_<:kY xju#TTAm_=zdӖ$3߸џ5_:|>lyͻ~_﹪ PSG*T)ұP 6(q!t-eNŪ s?ϯ{ô錏>Kk` #={>{!|֦ΟlygO wm{nSFZsٶ;~<6k{ҵjƎkǷ|G?c玗jK^}tϺ{^-y'o3O?1Q&T,P<*u45\g&Q-u\En&jZd%`Tz#MIUĄ_t0al%(%\T fȘ4Z[$bzqũdNdڛ` z'(f3Z|E8;SQH)[392ͰI$9 Q46?HYVfXȹJMT6S:UEK)\jqZ*+Z-i񆯳uǰ_*U:*&pNBMZye``p]N-筂]e$UȰ(|[:O$h -2PњL!P@1A1>Ӑ\BtɃA`;sZ-^52]K&^t*rKؘo;C%h@ȹNOmbl@$s.! )JjMu2-@kVYmi`xoc'#3*:)sW?>x}رcn;߶-zU&4.x5m姫ɢEZcZmh܁j"4>;c63fl{>rsD[m #;w><־HX񋴾ߗ.5O'ϝw'=+c[wz>mlۓ?͝{e:ݾѡ#W?pwnk8Գrk=r<#~r'Vy};/=X[r ox}S>ԉw>?}Ԙ8mTMh:dU\ҍ. gIPt 8[AsXK%Պ_ Y)f|; E1̕5Nw:X1.R qu!՘*mڹ҃=<ˢ ffx!qܒ!-TiHVx%.5ۀ]iɘuTar yY:CM@t̟KC􌜎w/JRtpNQe/5ؒ׆ p9e&(gRqr4ޖkre IV96:>{2Nt$\LSn_|55Ϸ_S/W_}u1j yt-Y}Iz!Ϯ0ό\|5U@R?Cクa]HEZynZ_[n֭10K\9uj7UWGP4㙍{05n+A"sҿ.]87=1y擏O䱣6o}CV׾V t?=p=Ov,۲zc+oy|7O_K{w8<ʃ%n;[<Ϝ&ΪsO8JUU#kL7z>֚PQK$1APMkt[Zkȭƅ"*ʓZ:qdU(d:u }btq1)Qc\ C&j@@ ^EvF^&K[)L9Ea022C؛8qP-I'M8p`$d+z!wdfa]幨82 ($3:FE&'Sh'!qN؟Yk2TVŊM\^̜Z΍+ ك I)DfTދ+39gw.z}ƺk #;w>X/GF2fag9*iOML^:{G7hݛ:nhپW׷wiX/ƪ}IKcƂEܮ*-*KJ 4H@ .˺² ("쟻9g{<ĚuNNn9sf~3{{[[t/ :4C}:t>nY{u?߾-ˇ8ѓĨj5ӘhMLƍ \4laEu ?m(,JQȓF6FhklQU.;F{(BedNT n5P{@A#"<Z[īZۈJ)$ڨ\a] s\ul<DE 6,ab&{d2):X%W 8-򍙛8b~+wS馕xdU*S(az OZ:C뀉Yv m u)F j8M.+G".5G{KBhssBkS8Z 4NRP"$<1ef Q8z( ʁ Z)$vefڙm:6dRl0bxNtNȤNYq ' (?|nnPS᢫W/}| f>;|6ϾsNֳiZUIK,k{V CZF)sh]js-Νq6U3c`\=;uݬ}zzEP4W~].z~^865qgc[ݹn3>;;vtl}K=u[imwswࡑ7OБ{{۱g==յe<}뿿G:6x䱱 jcqƣ`rBk& \Pq+ ^D"nkfꙮ7BZTAD4FLMeQ3RH;l'V& BD"m5FFBZh'peꀊSJ UŊ܂"xb̠Y 4cDU6(j^!F>@K&,`ְ)OIq(+ۧ*!d zqfk9-F:6Jg"{%T/q}'M"ez̦ENi)pSՒXEUb8fSJ1-EGi0nPz(U*)OSZ5% Zi#T="V(`&j8-MȌK,V&sh95mRJ Q86u n7@`u@kj+E*GI¥b 6ǀ2ɖYZK$\fUTV/Sj'.b&Lb)tNĄ֜C)bk0yKnqf'h~mhhhƍ ;-jVߪUv+ZJxCzoշgWWzVѺ?'\+Ʈ"6y ?rg&{4q5}dfD֯_ݽOߨ"Q"͎tO[}YVkNN&j?8ڕϭY{ [kUmK,Yҽ Yn|rOZ8pGzz䵽gG;uW^cC^<Ɓ3'Ο}k a}Q멚mmaf*lnA"J&(V M`i#%b>eQ;O !a) EQ*բ/#xc# (&$悦0/JAKa! `㰷D /[xYp1ʥ.\ D&5s8#-F:b)kZ.'2L)i"U@"O2W:T.bR eV%3F&IEjp(VDD)K*])s,KN.%)LS%bYcj%cӸLvBլT2Ƣ +EL$o)2NU3 iof XJ&I/OiBlYF&m[{YvՋ-ڵk׷ʕ+_=NOO m3m&JUZ8o#/=ξgOMj 8ߡ VњUT޹s5g  ?J3˗,]9fJdxi(kxf"Zo#[5US;Y>{߶5r]˞x~๵Ϭç}{^}upɳg Sώ}ܩcN=svLh0y5AP Q}2n]iZ ժD5sد,+f P]B 8DnJ*&uiR"}TEA@ Iy5Jc{.*I,XEARZAF;g9;cUF&g1q:ls3IJ8 s4{C![=

x/~ų88KNdp#K=ZnffɁGGΞ)F< ?343B|r Gz޷>QMkST:1y7_;vYw˦[KV]; U>Ȯ/0gc^}['ϯ_};'߹PO] ˓Q}2֕rsj\Ҝ+eU*؎*դZkVmԴQh1UаA]tڨ 6 '2 lbÊZ5u ʎuXsXŦF$C6 hEa$LpͺW\Ȣqg{z:^,@B)ʽ A)!)PӚ o0 ( )CidLll|yqsg<ҍ""Q%,XȂ hpk q49>s9 E% BGZCn%J&0OġýEXl.{WQҸ<(Ј4\mYNUӵ~~-;;t^g% 8zdʕBZSbΡkZFiuŽ4|HK|*!*%S,niܿ D RƦZk <6S:  EŒ1HΝm5tiZfE]um:x/yҬ肐<`8Wݳ-Rjö7wPwm>pW}=VJ:M^cGn47z4PCBzӝ+7o*Hڴ_7RKG [&TS:C%R~ř־B`dpl8N%z"X>/&ES!Vpn3\Ah,qH׈ݯ&)[=zrƷ^Һ\ʡ(8 KR}c=gKL-%L!(8x8/ip]ICC_\ϛ7 r.3yD˦4*)|٤frb߻Z/i=廿Xζ nnq;ukR[R~c5on۰׵+իmC O>'}]v6v/?4hG(U,:-Qr.hch]d˓вMLk ֠5/ bZGVܜAb$r y1$EۡԒ|7UP4mC!w">Δkv "T9вp&$b1^DҰwq4V6Jѹ CcqudTSK'v]"\۞#?-sVh0v@x`|;y 3xG-]xѢsv}nh뒯G*+WOʌ #N[liR:~R$hed'ك3gΜBZ7% `֭Y.7xD%[%~dϘ1%H_y--5~^=GuLfFMp8j0CWkر5)'1/i=}kFl܂Xy۾`[JٻȾ'ڳv9h եկ?T't|zz@_m@vrʳb.Q5!.cq+#y8!XeO`;Hnň[Z.BCPI&)Y0U ESZ f2>%s;(16.t :jW&K%E5]n Ҳ"Z3+\$]¶pJ'-,: =`}2Ub*noVR P  qકAWW*'ĭ"J(Q'5 J>(PSLb% >.?puȊv߸KSAtevpⶡLR lٵ+;s3.lFc-<:YmAOgg2g9 Ԛ߽z7V{{>MC͑˄’Vrŋof"BBBuygϜ^`~ņp7bQGg>w<+]je% & @HA(kpxz`6e"7SBDI[dIXN/ix!Z@1m fRp5P^(?C]_IJ0l1twt%Ϸpݻ7%C@Gl$Jlmmi])Z)Z?9ZOi$qdDJdJS2 :db88֗J K" H1m Ԁe lu@R8@$mH1P%blM1of.HH*!]\<EJM"FWs|wh_i -O]X:޽GGFDj_=Ѧ{(mٲ'"$c񷿺͹[ CB6y͝MM|ˮ mhy]YӲsuͻ׭H~?xm sf!.|'`)3 g3n.# 9­(B +I"k|Y/ZњyR C7DkP9J8$>)T$( Hʂ!+^om(ڇ$YH Mi?\wn1û9tˊUi/DP(c Ak*HYp JD}A_y4*ħ `?_k;&N8޼EZ%4K%_<> 4[3U E9&3Çek0 zՄyѢ)2Dp:NcϱdQBrۡA4H$Zs{̙3zOւ3<ߠ@9|2,ׇǏ_ֺ*D\UUW,OL0֮}HmKtlPH*dRWl]"%gMM?B_z{B F`{Nj$N qx$1T*hӭ`e] <:9:6"Z8kQ H5 ,>JEH@づ>Q/dtέR8h'Q"97X(KyY*O|}k522ç*=t;wf͚5iҤti c/?+n -X^o뉖冖---c_O+׸xti ??w86{uW#ˈ|'MM=T]ƃH.:~ Fwc~W##TTnI9%Cu:uBcGwZY<}7:ξMU,jCMm?3^8{k^nSn>]3)77 ŬI30 iP6TgO֒QPze%.4B.F/[XfXebխyوU 0e y* p<5+ 9*fe w+*UlB Ʒ}$v Ȕft͘`^d(L +ZU"xWnmh ޶x#Ǝ2@&D̋DCeom޼gT/V}ӞX 0lˤذZh+h'b Ʀ5ƌIܾm5 i5Jְr4T@9sf_?i*Jr쯦) 3M_g{r>;Xjc Wlʔ)7̭}셓絴ܸzGu vGG:֬ *v%S'COzK!o֭ŋUⵒXƤ\F l,#c) m-ZyMrU2E&*05bCX:](T0?ZXpJb8 ]g/?Ec}e2qH]]].I}v}ZEt@& a'{]MrNe54kEV7BPuɒCF0(m4r wmPD+ѵihQtX[A#y&H=ZZ gH%k*],z`߻//^g=}&n!@=UE{Z cH(6yA݂ 0*10_TǴN` }-ON|Wmo/?yԨAٳ7V|ؘn|ߙ;olC2b`T+ O[ h ll!$``WJ8JFB4V@Ȩ-Z]D&t:p7"O(U$(3N8VKlU%vT*ti@x551vl|m 6\064F&@TpP MGx`y̜/YUUje ,XoN4B⊦jo9s`~!a̵9ZڲefffNaik׮pjjJ(18/L2DgQKEǁD 'Dg0F~9Zk?^{q]OF?ko#v,m80 w5KK G0oyYr,ǜqs 8 ڍO/%j[j_M44'ۛm--l\mmy3sp{sPWϞGXzT+WVp2s֌h$BhB] ] Rg6 ?A5%(nAؼ1:=ۂ 'K΃IRF$,c-yjb&S ې^%o@,hFDS"p)$葨O]ƺ n*(6oa@pM &<%xŋ @{@ dapzw,=t;>& l^Gıckuee?>MT"DW 5vWt겲r5/Fa/Ο9qzdh G^\ϡ[!-~Ғ{BJ!ISp ^Dk_XK,ٺup,S9pC PDSB/8 %K *<m%ꬠ*:уB. Ns'](I1@n?9(ZIlj)+g&gǞ_1Ο͵AQݮgt2N&ںSI{{{箨L`gkkkچʺu DruŎDTE_lfkďS5KU~+Cׯ\yfdc̞ť431,3 M8` ͐[!˄ `(a* .w`ik Y'L_Z0z 3/ta{NءR*fCVYB肬Ke?s ' KP4+DG>nlE&YPZYb9i]>w4o)VXNlDJX&q\( bɜK$߻{cG[[Z}MD>rBx.ӏJnf(RV(Gdž>>tEmKeQX%eX kLp円U N7:ÅbNeT +3VXӡaYCőq~n,X I.&%,Ji\`nxUB昭--:mnj2GFh*h,(y7:;1ˤePXg#."/Xvy֕EL[D_tPmay,yIVT -|jŁd cMrXj*IxK_@ȇ"S҄}㳧Q1;ҚFFd2AϠGq7nH#G<~X \=x@ݻwԗ38933333qf:j)EAg+S/,:<ϛ7/1G=Iq^͌q 5 )mfqHOO 4x<ۧ"-|֭h|۽/&N2ӦcұcJ 61jgFnwu7mN֮ߜXoloز1Wk;׶׼5+:*^YU?YrkkwTbю764f߯ϟ§Ct fftPwiFP܇tCǡ] BS˗-;wu|Uɪ`E QۢCImqx4151P5@Ҧ%YTL!Ӏs_ycwU*&*A6BkFSV-U>s/&s ޕYmqc2wNHstށdO 9vkWuuuzLKcHlV؁{Qk; #5Ce"a^,cr4CC vSpJh8 DjqIA? ]P,rCN R;[T!?O|yӓ9?8J/EZ¬z{Z2+DZ*j5iVsvi}f. `yZg%u>_s'^ڇo83_#!{[xeoMMVG9zn_)9>%6k0pqp- ͛7|λCxmvtvvmzW׵u-},ױbaE] [Wھ<|իѝ19{4KELڰ0cZ6p1"!вK&*ka0/d%Iv4DԂMЈzP0f@@@ I Tfn"[ pRC_U 2+VnT"06f " @#.k8ʎR,(MOhmNjEI9z!:$3#A w.AdYcvL#SAД%!К:}Euu)s0Ư=AՑ 6BٲySK:abW?ˑjfPt\quuӵ75Smmo/.I_xֈۡcǂV;Isӗ,>88MB8 Lؽ]*Td_3aPhppYaZo8[J}=;wFejH&JHsc c2"f%-tZ&v3b$͛bJ:p%y-BOb%fc8E_H V!j7vI+I2 r_sS4_T<6OYi^,eKZpGl51lԜuZϼ'(It'otoyš/5Ŧ~gnlk{U5uAws֦;~Wo^{91Di9.q%@"|z-<JS6 ck(%6CM%p |teFK*e*A܅*. ֦RbEƤ/+QF;$bX;rC$SJym\`-="wq9`"x.%B{2n¶ CM!UVp8LbxJc𵵵Ӵ>K*c@: %,l9Gw!Q fiM$}zE͞96 DwXgϯmB_YԂ_t[׮!2R W… z|FZ_ :: tu544cGq?cН'/^c@|X$\Zj%;ld@}fJiZd s/_ ӂ:K/F/]$AzRvhC ?j[LJb.S#EA$ 6B2_ be)=$\t%RK ZHtՄ96 l.@B'LEty4^ H|4|ҥ.dFq}şh<^yZ={'ur\a%3䲴঱|> -Ykjj2zU^jf(̦Y]3Of6J'.@̖%c⫙İʾ ym1F;rٕզtIkR4>,D$u6WGjjS="|$BT$g8wRMipք]ன][:mr,ӄѱ;׮\ շe5{w[s3}-<ó}+/ߑoغfY z7?qdߕݸ>rgfiFwz0 e|⮡RZG%H|д8T} R䣑5:>YZZ" ;v0B!^T4%ZHRc%N9$!ROYS]ى5ⰄJ`R=]a7ԯ/t<KABkf~:Xrtr 47ϛ7766,##.,,.8dl9sϟre: 13^'F 8;BJsh: q:vϣ xlݰJMcԸٶ3`_pR7S+JLcsDǞ*Dbk?E3ZӺ'3mʹ4 ߍaGN?\t+a!.oD10Xx4wh[}=>?{ǻv]Ϊ_l]oxy To-ѸP˞[r  y9z{` fa^0/bE p0 <([9(xQ-`O S- 7VdbLE\QqpB 14AT#v< k<'4~9 rOnHh"EqNƋȷ茕 D3ڙ .:Tg# NHs'К$bdFk1~kmق^6/DNk5M0wՆq"Omp=u3t(JK`Pl3% 4xƵ+\p!nhX~m]u `mm6&#OWϩh%ۻz )P9H,uO)Z74cyMbd^aۛlo,HWF9RӲj|={w]QCw-:s6f8~-vy.c)Y8`<%$ )JpnT/]e{?f8wWaQn~Aihʕwn]+Z*d_kT§r4εf^`^%B*8'J R$ؔ)@@+bKOVsPz8HqLG/q dcB-f  +`ipNQCc^S2nQSۿTS4Ӟuvv=zvժU?~yc*ȳf4T:gol҉L!CiVCYgiؾ|>*Y~y> <?ʠB{K']"\Z1 5u3($-ӳ&"9Q/y?\ßl*d̅36(Trªvb$, hċ@ &(J?f!,hLK1pXQ ,p+O!1d`G!cB&bf_= o_8e I&Щ˄8d9^^>n\=X?q:k֬$gQ0EQ3UUUkQ{DXy#DB?ic#b.^Oh@HtTYyjr,щaݗ.cz8 &+8+ɬLP}]"9RHljGKhxKޖ}d5eanz:8o El Q JRn7R5S)jBKH++%i6US)E}`‹1gy;/fBT, RUuQ6HwteΙ3T(k]ۍaL#jxkm̝*̸=6 LTI.6mfrk mp+Ua_#BEmSWV'j$!Md}gD-Oh؞ݽ{wj,DmH ҆8mHg^W>=(:JI%z:uTPS/*(ZzfEzk֍W/-.]_\,-tϟ|•KW^Jyr+[ꤠ,hHړTb:raf80yqp<lIi4tZh ۙ20z#@dtư"FH0.^ oTD ~4P߅'Ƣ+ 0N/*Bࢠj֕ɫոXF2W+1n5Z!SX]$TkJ/} BA.~4==0>xEM e/d =~+u :511WvLܼ1299,٤Ҩ58}W_*P{ZZXx+9"b.+}o<$+ pA x޳v91J~Hnjpdϟ9= /c܉Cd4ܼo,)`tO$`IcA+)_TD#FOpsR&Xvpu]NG@)uXyF@Bjp 'ABGj6^eVGI!ښ })$?#5l($PituJ0)3nkB ZBdu9O_}('n۶m]|Ν;YI1"1:zײ [.hMX9cc7o`ʀHU ލlq;&R2NbQaJ:GZl{Goۄųll)&أGE1i 9]ŒJx"@_}1׺MP>yV4iCZo6@k{ h4o|!A>["NrSJ҆DAujSn/k Rt)Q`gKTh6.8P-e)8>yTiV=S+QUYpx- ᚩYEiC9΁" ԄuZ Y5j\T8ʠ,Uh\#Dpj<) >q S@\u2ԠG*[k4KB2 o`%g /k!LUr rʪZjiǴk̅GGqq;jAϮ|Zк\>^^8wP}I58p[Z̲e˖_=lPTrG&^W\ڻ,ke6H ͟{D f 㤐pawڇª~\䕃.$w͛&o._{#6Ah g&oاxUlg;Z ^^~%Lkxˈ,FiSJB rB_r$ 9 PCހDد:<_@(1R񡆇zBH%2B m;Rn Df:s^g7c"_L$c~5}+]\Z%ec;'j\t u}#w  ?v3 6qW5lJׯmXO` /3𑋿=s䉟iN!;iZSc.wpg}翹bůU|c˗/Cч$*9V܅K/-_w`SGn/礓p\!IR}g78/^"Wf{^@!J^B!kɳ yy+ot}˜۱H]<\o\aՙQn|;gΜٍ[[,:d͘eXZ7ǍTلՍ蠵JHF7jlҩdS|/'k(@tU c]4Ma-^7tib漦2.CU2i C jL31K ] L'rа Z qkZ)Uih*ۗV֒t#iD[4!hD C?`;5_Euu CтtƺcsW׀mc~ @#:\=%!ֈD\j||ҥ^]y9!wU!"=/Isցo۲{}عcშ2=GoS6.\Z:r۲'Axݻ7oڄumݼw@c쏒ۓCW<6lX}[y>={#L>qѡk[q:ߝ;w` ~S_~޺w{>v-Hp]KmHCo=8{ڕ#:Noe#6nv}-$%gOuƅ3~28_^rK˖^}l|32#v*X~[<)o88+- !%3Z+:9M+9,m1-IPpuءuAZr^gJIM}:ony211`ϯ]v޼y{l--4j5nh(oT+רWgRa|U99uϯ4F?"2`8*n!F֮]Xڧr|kX,hI 1D_ thI\ $$-؋-H cQqjrig [kĚJ0,cFٱtGڟB#[S QH) [F>E,D_GoJYoۺ*y Y<ުU.vxna=NEqI2ŸbG􌁼fFh#B6>|T/; F2,xd^2ڮ11s,bUFV;Iؙ̅FI tRG}iS𓯱-~,k"W@CzA4J%?ʭenX$sq@e\-1dmE _ zGSΰrEeݖϑ,N2N\m9 ['.3׀Y\$Y#N`\J,+ `rUgFƬ$'Ւ:IN*I\𶠚aX:2v8--Oo?|664TCg. 'nhڵj:D>Ī̪Qt ׺M37>K DL`$52vЌ<0Dݹ?4%N% Mk6GɅhQ`P:l#*Uɯu|zDх)JCf FDЅֹ mZM,mm˚6XB푧dLMDzّ$8,aVc;"3,FĪ5 D#4J+Tt'lGӿ[0h!%{@ѽ7eY/E3=\5=Ӯ OG=WQyR]zA e,b,7"Y^e"w)#1|NoݜS`ְhBӵaB`två+¬Fo:&5׾,@T$3$4 &\%kRZ3Y@4 J5;`r[ I*,ƿZXࢳ_'˜8!"iHۊ$ CnqٖWjrp$ZwAnA,n n %%Fqm\ Pr.|k:g)u [ [#9m#:[pewDՠ!Y#~̵`b)>N#XvZ%yMlK N7֡嬥~ZWڮ["rmD>2fo㺱e ^ߴ\ʚu}+cKaJ^,!߰77q kfnIHf!s FJ_Ulllsh9M S GF1T z/P%Z%g&^UlllshYKis3e'~BF\#v,~ -u[4AY 1g$0OƳχ|o޾r:|n.{7_ŏ|&q%qhqS97"%Fj1>T2L5O&qkK1@RD0K 3q dAj4d|8B[G⮶6l2AŹpwffLMkĮJnԜH4'2K62Fl0kRD3v nR&Xj*uW f(0WfzbZPJ 1PUN71uQX$ %قj5(>Wۦe[#]Y_ҙ9IJ/x:_7ܰOpOܟCNvMxNx:]<]rx8 ܸO#=Ůدܺ$FOޛMEv ~B``AHꕂU[Uq-zz^6͵.MY늡+'MYs( }5 ;Ǘlg;v_׸.uTkPKC+Y.ރy+XfF{wjzkiyDǦdnߑް%a çZ31ܭAOLYq#Hɫû#j|$Zf-6vyz@ɏ".9=DZЯ3>C׋bf6#uJ$UܶxMAJ93v :dZoT gP8n^a]2S?ԷK-}ڕ;Kp;CD`׬<8P}^Ռ{@T2p+Gy#u^}5tҖk׮Q}Ci97ss 33uy۷kU5l[ںkbi햁) Ww'z Wtlg;ۯ[TcJY=858@Mhihvcą^,t-]v =wO}os G{w*w^G01{b|RO9x|q=$܅F60HTm7ْK{z^wQzut퐛˔_UֳZGDͳ%.]+gwLju]wYF bl b-n1"VD뮭rj4` MXGY>(*f7}[ ula`r~d+HsZi2g+:vWh^Q=6zj+d@@KhmEkok'䎙L@/qT_n3NNC9K$@e pMԍo⎝,4Ͳ C ##,2@{\jx,fUFJ *EeH YoɅ`^ɢ11$eixmp'v9N5L)bNOK>j):.q+J[.IR@a`ԽI%b56)"~쑂"_(<ɏ!ɉD{ y*|?^%gwOCB1%J%Ӳj7DꙸXʷm@mCKSOL jh*fXzc->6hK[\24W2MSm\:@w(hOM#o]fK}Sr'<>?~lg۷_4; VzY;Q̲%zY~Kw*ĺW]v^Y;7#BWgBÙ{7GgthQ=;r3":DnFaîssancGv-V6א)VV9N#(3N=<ŅgRkĠ%W1+r fl['ViV5/rcY^0VЋ_JwbY1f]VveZ8HTF*Mpزի%*5k?Ex 90uݲYU}{]؍ cfvC4X3UtSY;XHUNPf Ia=h=nd{ڌBb"ȉk`O?(Wm;<JjQ3lL;3e2ƣz85xIJ*@tF_ݢ[ͲM=/y )0UVU>/VVEєySe g)ؔIME,q9ky +e+lNybYR**ƦM9vd5Fl^$(`g7!SZlWPTC0<ۢh)6vg XrlWaw,y\|fy Q0{ϟﻖGp{{{U< w9~~V\Ak; 3$gzI `?5=@Fyُf oqGcOޝvlъ7;8}vQuޏgN;5g;:Qxw'oƜ?=Aȓ'>aƻC%#';O-mHP2N>fVX,k~2 ƍR=Tj-V;SMT6p_t^+XOΉб8Fq? \>4 52·Ѕo ;3aBSut5Z t%nAXؐFHZ)O-v~,dEyy<@Y$5L3IۉK6l061`wq !tSC&5SYdfCWf7U]SSuu82~{xv Oqb_{,nbb`FAgz̀p1;bQ֮olJr1_ *PlVrRU:|6˙Z!]ΑL:GQ43JΥ *MY+DT@+EZJTD)<Ɓ,Y,t( g"lCNQd2aT"lL"Gaiax4J\:MTEd2he*Jd$@D$,+d, SPQd8c` H łh={>^ x}y˸mEr^ml; j;RAO&%"ET9Df :&ݤ rIC[Q:j[zQů6o`Vu]@ݻ.纛'_ZI.q:]o74<}6Zi!xSHEjZRRlyeZU͕|B`Kퟢok?ǏܹBKYqqqkN[ms˗/߿h4{O>vxZG?ţGz?! ǍrSQdaE\JgcjJ@M H2 v$Gf [!!KW#y=2fa Z+X}.zsIT8| sRQ.e ja ]jWzn n x,CfCC6$ |g8f6X!j7 Q,*A [A&x du%˰0tٯc^W"v93h0Gv9jwn8jvܮUvՀ8nrBla1ӪzQ-bLvhTZ d^(Ԫt^i5F^*B.9t\dt*uP Rg |&Y+檅L))RdLRDLD)2|TիJg;C׮]Zy{F"?|F>~@8Yp^`d œy:Y'`p:?8X`t(Gi1s`h|ؿχ?/8;g\)@w;3ӎ.ɰ=4<&vk z~ ۓN{N{LNo~5h5p| w 8kfyZ9m7jǧrQřiOʧqzX?)NҜ9Z95NiQւi ~4V,;|vFӃÃ|/dNr'=tq7KS|*B&IT,zP2Kù5 yao"M_ !<<06M=tu|pΐg! yh +gݔ)@]cV3c1$fTfE,e4ʎ)z) 巙)cFZSX Z JiĦەtB%6A6F "q$"4"FK7̢ULhmB.^&FѲAK* xLjF/sbrFbMe\jmhٸ-HL>R#ѐgT8urZ rڠ ˶bD P _{Z_҉ʵER9LƠۘp٧d0OPT&x YQxeޭ3tkM+u}Uc6Rىi P޷_۔dkB( :O Xsnfc-"2۽}WK,7)VLSX"a|ke)$}CDl: It؆6à.vQ%@k60Ps@iC|M >|Бŋ޽|>c2?fK~=@pQ{8 0Ct<<ó1 og?M@! {ZUkfӨnNkzݨvZA?fQ}֨+n>v`+I~\l* 4ZX;.Ԏ`.VRxT+JRqT8(灬^l7w|6DD6%T*bTKx(!?h3u&ו A,dr,:Sa6wBp A9:9Xm7{( W{lFC:I3kV^v`zˠ"5gO)R1p%aJF{)߁G=jQ#nq982"p g\ѹ'³Qw>wYt;᧝&ˌGYڔO!&XGc 0xiNn8IΖ2ֈsmaHY [фøK"vhG+ " AL7)D*cTGlhPGe$ cU&.šT!1쪍UPM~U G)+N.|\lQnFHQ])Ԯ?6f:ZЪwzI,ZTR2`M8d3UbSZ)& ޜĤ7bk(\[ S->1Yܦ#Z[g,z#AIaʅwp&<+[{`-Ƣ&.7c=YHGX胞>ϐhSV2ytS+nο-Nm(_F7=5`Vnܽ̿د< }5s3͒8ǎmy_$[d.klٖx 1 $0L1ITOq\2]5L7AU~a[cfe m2&8S"q,kbQH%"N8V2]E@\2N/z_l6|E wڵw] 6o߾\t ܑ(t: <;;>>ONggg'3퓓gg@?f^M_8:9~`2Z{6fzMkh+4TĪXu٪k*\]2 UӬ V %]$565*QM]|YCƐy͒@;\K2墡 ŪH(,ƓHRRJyd-`n2hhR gЪI4^"aT2X @4nJ ACnH /  J"FtMF:) tG%aKHl{u#tTKg-XW?h5mDE6V鵤|9R/IX">m}a6lkp,0lRD<똒H:R7vCFaslV¨KdhmUZl:d<"AdӖ{T,EڈuTlfO?-754YŤJ`C4)g";2D:Xs!рvϢP%)eBN4S LZU!`cqn[d.ZuuH@)x:^Y`)(R.ވm9ٸ=&M-rpSX\_2W҃%,VhАHW$֍ Ε \krq>׊S]HE$兪Bd__fNx:o9~ֽo9V2iX|yVU)UQAaɠ-Uűz] _^+M"O S3`0Of_E_ ˲KW^}ͧO.z=0͟rуwr~9}>~b>ezt|ꇳW\gÃ'O`^qpdm0*0d< : RY4YUΪpoU-C8uz !_FF%Hlot"x].{Np647?dC&GZ.ښb"=ڪL /z泡e㝗O|I' ep2jj}j5mmkVS]_v&fIH66hgy8"!_3Zuݻw4M_1ҍ7u;7 #h/zZߺu O5W!XH5R,*}f@^nz͏.>B$e2OsǓtrv~2>?9<;?_L_ϏO6z]*21H#d?;:9X?~ďvx Y*2A,hV!OpZbHn*>ޞ>`!}sw;{[^bVstYm =9.{vOUvù&jMPh(x&bJ(/rAvQ Q۪zwC88f m >5G3fB5'١͕~;Lm&uhؿ3InNfҫ[Bg/e!H)jma)Y._#l1Өz=cz#|=kbaFlYYr;ҟ3F^.GBL0 XlS JI*iqy@^ !f; ~JK {|CD" BF#7].Ecc9p:(.[Jd#prhS+(tȖÒMAwNQ^$6V*cvBwRDִ%q"a;tsΗRh)H ̯(TljY&H KѠ'pwaْd*q2P)dI"HF*8t%bZӪh`d(|%b~,56wjIaعHӘ cgæ[*4"hcuRa, ^͢&f4TJi@dRԪRV`R!)]'PHKa-ґ d3S?x%siV%Cn4 <ӸЩVJa~y>reFcO|^3 ۊE `dIfX0A.{rS$I3$:W?`!aWDCGl+A~c ˗/>}*x@`D"2۷ogϞe-|IŋM 9fl?[k]v%.~@hZ~||9\'O&OxsC쳛Muzm2zQ<ڜNBiU"p=aOBOGjdRpg>p4y{뇻}ո};N3l2J){8&$NF֐}<חePp:MS&\`Ý>OD$s¤|; P+jѓ2 >p8ku}SsjOL : ow9'H`NҸк6*Jqd3لâv-sXn l׮XkyZA& >',hԀػj26W/_B/,7 A..D.B_r]._u~b͒P4N0hvfkJS T FZ^JZǷZuvwz((v8K6{u$\Qx=F9i<u+rI_ XgL 1ɠU)ey*LDVrr/=3q ebFaU2DR,NeeΦ1˲(/e8T&N THؗ$#vI)".!K0oy 1زv[uD0j&]" PZAˤ"MZ4,DC>l.Țn%*xrEa[5:ƕد6+90?G|8Od@gdkJ$6ddsfSb"PdR 8|!yቝlc W-{ J+KM9<#rkS[L>D&chp/P8 ~r T$U@MDPkaaө؊xJ.KvS&#MYEtI4G(Bs@k: &i*8VI>}꟢/[QMPܕ:P({_ޮ1t Xe+<߼ysMܾ}ƍPJtSn$ (>6~ӗzHw܁-\I޵k~[nϵ|y~<|2^&x4G&''OǓK]`l4ڍj|\w*szZ]">=M $`&@AtH";R rniBb%^e"4*!1tHWD>1Db&Z(0  JYjcc}C@Qlr 󭮈".W. ] ::l6l]R&e$xS}`~ŋ:m={ w$pիW?_bzz+)YN0 ~lPw&?itw]r^$39Lfggb1t'o@1?..`|A>—_xy1: NFɥO/idOFӪR>+1x/F'qsz=oZU27G*.ZJmpor!:NvfxZZ' J'n8)GG8$W)fnbp5Aw0BT8jl𠝤 V~\/ &Vk_W l/ÔGM"PV=holq]jyfC6*ݺVL}Ӏc^o;NzQk(+l9a3?&dtLNcw&(L6_Jz )DFmG`-NVTJZ86+ Yd8ᴛz*,6wJ\5aSɥjZ{^X+OO:i *ba;$KB^.s4WezzȈ٪M՝Ңrr، ،zUQ!Gz38`A?jFqL^/˖Y k6 ٙ{b H:7s?qY28Hziՙ \t;-  8C3CUraf d6 RPoׯKKZZ͐_'?mY/crHK&$! 6mllUުlR0ؐ(Rrir!<EI#t'Q}Xgѫ֖c qnI%"¬޶iU J$tlNOR$&^tbV瓤GbFD"<ݢ҄R!878v2@S1@Q*"0-,ZLL Ӓ @=3sJtB!p/Mz =L~KH uɥ˨ MFd@W(RI"η*8>>'0{K>`_QoʭzI)]˞>mgaŗlf#yvoW9[ORn-bg<6pc8>7hԝpt XNl98wZuɰ<跔ʵ M >z- zEW( D8oV%mr^@B}dƣxYN^aRi٤V. |Sٲʝv%DJ۽`v*N;ŤɦMdPк ij˹vnsrZ)3:2A EǃE&UHPV \@Y:Vb?RYc)"Zf1Xיj֪PucNdc4OM.hQO$teL<5&r@R9"`&W`;?qL{P!S1/sa zAohPG^[ BZMps$H$V ^ujg2M*ZaH1։ek$chq. >Y t"S+e6!8 zMZMUcEmIk6Q?f7T(B\[0 n t+V*We:02DO'0ٚaLݶ(N ᕬ>2 a3ƆZ.]QpVJa=]qJL:!.DDqbҩ=g16//ө(%+: z73:EbA|q2*y$Qs{Gq@ Wo޾}rnܸ1Zx `C~i-|5K @~@g9u3Y?9^~ 8ZC N]vWhj\ 'f~s /7}u/`xP/oӃa{2==;=Fѳ||z6>>=>49ʴT!T+G͓>7 gOw>5uK8ێF5"uK8M 0j qߠϱ8!.p:Sy^A0Ǣa !.mkYTBiӤ;xۛe۫1\Q;j>,iUV%3%!ӪX-*8S(ZM.Uf^̥MG¨ )h%b!ߠM%bU]m(VUoo\F뵬X,Zgk%KC#sjW IL:"Ttnc+ߧ:ڽ8sr `!Sј_$dww 4R#%BeɠojC>4_[e+4E.JL6l&ީy,M7vII( D̷9,VĢ \Lg3E-\*v(ޖ D:qۍ:.">j) 9E"U2ID&rX5Y4h9 ɐǦS^'ǒ[٘; ۓGӓo{\0=F!  h< Xhte<Ϻzh}pUIo6Ŭ#I|H$Z34ѨNbh'˩bWj՗Ξ[٬gP`gͪK,;?x$&(R.\:taZd1TQUpaXP=g243v. Mto֫[bA٤*80a3ţa׈L>ǘZA~oגR)nnk ޡͯDVH ^gQpOTd$aj6,,KLbwja?:h3K 6Gw;@>|ch*3Xd["tkJRTqG&nKUpmb<s߹s3 PxO&F2mx9Oɱ9dMq&Ė%wk߬ک]"%(mK^eM:s1EO9c43(ď?~#&]6T!"{wo@&kx:1rToR>"KFR1ݠȉT4pܿ'"A] X' ),ȥ"QJ=Lۚ<GRJ#J)B#.,*e~N^xȣKs`T*yɸ|V0d\﷮ރ~Ub| ^0520dICW*,d .: scQ)/GDn1 d!aG ]-D 2Y:2KBA<ڨ`adApҸ)~DdCjKC;T/.N?TBk U_ G0/^,--}qe7`$իk˗@,?Hb&PqO7o@tvx \8+)h!nP;(EQ/./Ň c^\\|xpufÃtqx~~p7 VԺbQhղg3|?9?>^M' 8-Q{ԣlVcF=Z)vZ|ډ!4R.'~kƝQTnvz^>{^|oP) ̓˖ dܛ͆R&Ĺ7el6-ԦfLk4Ny0h5¼wɰ7L76c>L48Vo%WiD̳5 pl u) zz R:lk5ȢH&A4µpP%l7I.ը%88G.ڪbTp Q[mzVX*`ml]7WvkV`0b  ;l^dN+ VWxU,(l6zKX}oZN-)f IATӉi.K -+wM M2Cdcw\Kwr2 VuZ [,j|Q#JO&޳ɠRI+ŢJ"M[>(xlGUJL5#hԿ`,ch̫K*4 ͪ%2!Mg1ie<pj, h֠ѝ\)|n3YBm[/a08% C*<o e*afÂR.̣lDG22a7?mZ-r YZ^Z6 C>_IU Q!%ހY,FCt٧}֟MEaŷ T_WBT^6.], ).>Fz{I DŽ5h׀s%sl 7o8̏D"r |܀?={vƍ+iN^ǡЄLx/hu嗟gLJ,.l-fi q1%ItZLNϏ',]x]G5Tf۪%u]+O0`_Q4lMQLFܠ4BvX23ZI`( yYgC%FxV:6gT*b.Ðzno2%V4w*2#n5֪Ѡ xlVP7Lr!o:x2nPv,tDĸ ~i2(t)|Ôzw yna\]Q)7{\1vجm i}-X_XÒ({m-?Yo|<1ꠘ&I&NرȲ]Vj'Y%Q"EJ"%ʤDIɎ{0("|$Bb& i&SC0=yk ڵ߁@c~ɸKSFx=4B R1F4DJ-U1eݻ73X0 z5CŃǡVD2-CdRȞfCVrXeZLDl&It{;OF5]L>XF z Zը !"{Y If%(ޝ66]N[~ZB!wrpZxV9lz]ñ6}rGF0qtt!Du{[Mhw6"Agrp&mVΤPQOM-PUFþ|;kE&@1f3* vLjٯvzzD;l@ϟ ^5@8LoX\xQşׯg.dGd0>ĺPYP0<\meeFN4mrg~W8/'%pv"ogC7- ?/_ S:L>i_˗t>ft8ZOON:9/G@׋@>llW`m]'D_`Nә|<.z'Gɢ Q[rZvYi4Jk|xnZTzhS'cpGbzGl]k[x$;5[:KӉ=h<0TT*tCQ)YߓJ_;FCHBc4`hn7)6˒e+ڽX8vUPm2Ş#NSz\Y-}U*u]Yl(=a35R_nMxk),l1&QZplSgwJa6l\-Ya!˧SqpMٴ4%i6*e\a xZ dYJP[WBA!_WKV/ m}tϝvl6sF8'akQDr]u{@noo<9I`D6mPzzJË"L\.s$ "[A\k6]R vD"^0JP۷iTt2g(t&bn]oTscMxbޅB>n2:C~D6K#[tAVvPd*]pf(ǝ=E˖X t`IL3Ѱ H"u|6=Jqi2tq/YH9FB>a8/pf47դZao֚ttҼSЭWB(^ְhKTYWwDU4FQۚգސDiP~pNt0dU7v*+,,:Gw^y\z*h߮H!߫b Ӗt7W4QxAb!gn- [2QRi'1,,,)vfVٮ̒@В&4$EV@QSZRhSun Ӥ2 E-!:yG{ Xڒи]4Mw<*o(lr&>'y_zgI>/K.oF`B_#|A0t:)`KKK|2va~?!Ϲ7>"[|\:cy⁹x]>\4s|7{d' LQ+p1) Z c7w3I84&d4Zn4ZWDhGցNoN7gɳi0 ^ؾ)/?|*~$0a2N3*%ڇf= Al&Z4]Y-,aQFAV:,>S$r!;NRަԯ׊QEvggu؆UOG\qh?^uq>ϒŃ-P_;(ܿ-rCq5q쥱&ˋxކ+jvmqq ٬D:b'QhvHmHӭ/۶hMd{IgܝUy#!Jewޭw k1[M46fyVs Xch-x'3W\9::(90Hi+ŋ&Rd?7. ]B`?]70ÿG~.p~0AN<궏BWNDuImr 1I `v48ˢv>:*3螤1ki4b_Tz: N)kNi:Rz@½,yOSzX.DآʄGqAM;v}c}5ȉ<}Y{[o*`(qz螭Ǐ\K;rgd*L`J觾F9AS7qL/ 0G9 4vų0j6MֶБ(pVc[Y瑇ҡ׭K8Idg!!FF[ilFCc⼥@50vh)x&茫 ('YU?.sCÖoei <K,yI"Ä0Lsfz ̄tӖͲ,n~,ْvwWJeXL(HHVtQ)Jttw$}ݦk)*-&)wtL LnZt]ou7zq)07WW.ģK,N-u]wYnKa$NᵵKY"Y:8 meDѽo^ڠ5-@$90CDңT0Os4q߾}Ϸ0P$u4LX؃ʮuk<٥6q.u0`d5m.%s̨dE\[bkֺoĮp^~Ou L'2PxK\Vj`>O4 G4P8 'Nq(j xi&;W^__*? BNBpta<$WW A;vٳgWqvÙo޼a,Z}Ę8>rZÓp$I/ D)`kGS"+@UpioWyx 8~}B^$IqƓq^UVeTe2)2Df uI9Cz74$8*qęfn9i:/#E:,Q$tj7e:7`^Y2˶"K ͪxXDtsoJ4lMlb*EUWE/b[s[MYTs4P"`^ b^i6-jLFAysӭ'qUOFqcN"qH&YP2! "iGv w" a֭kP-B'VI#/v>d Ov8gؒ|3=}iv|Bi|~Foe$1CHEM"wAZEV#\˖)%8еPMʰt"\OmiB; 9*RjCR=zw]BG2Kh ׈iҸ&F-^isǛd%pum]ڔ|n1֔5׮^y+6$ޖhW;!j5˛кjc`T*2+s92T&oc"'xo~-uj@W1eFA+Zwpg@/Nr((TUK \kߖ$/f_-, tֵk%bls䵮&2j?8꟢lpΙ3gȳgπH`8wܡV;y1677(_U =H&[nf7IE]9W$ׯ_]JS֋ kG!,0Ǐ:;}4n5 I_y}nV{Eu%eNlZ2*EUE}YbV͉6I<0#kZ*aC06 UͳJ#{VYd!tb#jI0t ޝvsuБ3-Gny`gz42*yPcթc6@5E7=I1kk[a[BwLx(;zUTqG2춟(ȪHk(\CnAMUd[J䩧??se!D!2pXTЁ^{ !<M"kI8 sAǕ,Z}o v)*!NCln OUU*VkbRVݕzwGJyҗ?ܸ!|YGљUZp7ls5pW c.ӺHنT{XvP8(o9j >K,|6bTGɐ"S)̀1Ƹ~_jZ﷮tZ~1H,dzcɂeW"ؤROGW^]ƤoU׎Σ>Ž;1%p:nȘRtے{5Ď6,l^H'_2{᷿W쵖c 6e]Hw[|y8\^뭫ucmIytG2^SL]eؚub|ŧ k~p<qW^G9½,Î>jU+҃ nbjF) A7!)#4 o1B_ӳ:L.Vƶ-tI0]mQ-Q'/_nܸ .oQ6 h!}P\renBf>H9? Զ׽7.CC^whKu9={/|o>q.Eh >TyyYu,‘e!gqStj0mCe4Q{ ;JǛ b+2gJXש ) 8'Ee\rOYDqEfGv:ij?)b7єO 0#շߒ]KM|+ ♐y?-ƁV-jڵ7+6 ay QMgBFh1rgKl;5*H{TȐo%$vujE]Sq,,9v- ZRTP`c& 5 n"wQS׆_J `cNkU4tP+}3փ37f95:l=um-4W~Bu aѨ"wrg ʕk8W|~R>jʠiH.b #aUȜ:Xk+TbGXc0Ʀa,ʹ׻{ hݯbSۃAQb1!e÷0n kvash}}?Ei q'Nj̅}B0(DZܿPYpF)@ .--a9Hm DJfX!908Ui!Sa :^?4wf^7] Ϝ9FsyjSsF9S"g9gbnr .x8=^%Dꮩ꫞Q2%2e u dekW\d*y(V&$ܨo*=ћN*3g'\+WyX"KHƮF\w3K6DO'e^QN; 腞 rñӲKQ9 j!+ L{Ơʙ!s;7 5ƵcUW#.h{;̶bj1bc;NNN r5XЖ-B(Z]ɦԝ]*\mVp#&5S߼;CmPBki̬qi϶}RCzC0hڕ^k g96j}WR 03"3zf>2جW4WWN8MQy9c},7ŞQB.]U|Mi˗Zcnny~>̳~?WӰ:vuNp?~b4@/~~c T>rn>Nl͛7_MJxǎ?w1xeee#T7/i /+-9ya#ݳ|AïO_uW_+⼈c%ʬo-IQWnh\ŠiDj7;ƨ>hJJ{/e6K[ }½pCm0~~-C̞6j#NeK;G9vџ>3'EĴmOݞQ_'Z&Vy aG\џgO7~pw!nX#gec v,n H x vDas~=ߖn^8Ȧԛu1G<,}z9ⷛM`Է%޷WGAC@[E9p2heY"]=<}3Zml3c$Kja ح oUٳR5d/3g=RTܯށg_jxάBYb+l_~OH< 2搮Jii4)iO,K" dYДk2O841ĜVl;&T#wSjM^"5rfBqlzyhS9!r÷ 8I+xb*܅SjW.Nld'u1>-INo4q#g:Ȩ* Wa(9+RE>\@1MC2n`a<nY [0vPtAy>mBK޽$Bdl5flcW7MQEl%:̷cX/f:I`;o`<=[֌r 7lFWBQ5IhV%Q1Fc7G]ؔc}B'C|)ܲ&MJVpq<ڛW?逥d0t H_3rlG={)Wm}ܹkedd$S(;lP( S^=^Jw>3⥼B{0UI#4CCC/K`YoK zB u|o#iVkۖ~_mEV$zvBhR܊R6f͌bD Wǁcے2:bob#ey͛__SIB:uc,e8xDEΎS#9]uS0S &tl\-Δ'n:u@tyu6V@kAl uceVS <Zӕ4ݬ.0TT9.רW;xCݷ_H,~E6kKl9i,ʔ:{.aF!ޤmJ…O|w||tjjȑ#{ݍ& RNN _R#zܡJ:¢,=Cxe0:: Ϡ,o֋B/%EF}x&k6VCpMdK_̙3XkX$IV ÌC|r89X|>v/(6=TQzSpҥMhm |c1xQ8ѣ^&6>ņǛk׮uo#i߉7ڞ^q Fm\$jEn8%K۠T8o7܋WVIԕk##zRn08Tۡ{Z+"O \1p)q'У D ) %|6$ԓ@56;$Tl{w⣣}L:drAJ\[h#TKđnKJ(lhM6K$CC??55H{:H!Xj`J`(6H,x.֚sM圂ٱ$Cm;T833~ۺęj9*bFq`-h ]MU0TVbuET@nT%If'_tu*)<Υ$ߒMG6ZB욡ki%R`,>:?T ӦH<6Ā:_S]ymFAa! l5OLfgOԙ}NOsw,hs)923 ,TSs厢;bYj)uu90o  秇/<ˑK WͥWm̡ U-"3GL}yVbV$K]:@y(5Z!ͿШ,|qcCٿ{wWʂ(^ [a`<==2TuioT~>/P_ H($r]`*X"% 4fgY<۝;wΌ!(E|όj]ģkt̹yΙ1=ߍFIlGV 6F!n00NvX#ۦ82Z`FƴCÇTs#nZ7iL\ю[ԃGI`{z30p-޻t]ȮEoZl)b"bw5O2kRP3|S:G*%_BStRYK乹kˢb:< W8ɭ[vk7V0w'ϟ.棛{8SvXJ^H.ֽ@'`o}ƳgmQ74t݊iE@q\]i6uw?=N? ۩Eyڃ45=W>wLa-yFK^-nݸ;Ɵ{0c剅۷fgg_vr)Ar?8"|@}:`ZF;ҁvb`0h'kcL|Y$3]-tfh֡Y$Kuۖ9/՛.yiho6#5[q O V8)Q+& 誂rߌװs®)k(&QT7u3d[WCev[crAni<:4Ǐ]_?kλ 7vT6$4z6#BX1E3iб f+z#6bQ:ߨL_5QK==;Z Uh.jCeKbt+ [kEVhV,+yBzB^Mb跸0u~4w}kW~/е%D R9.^ 3Ç/ޢ;ľ܄Si\5fb,=4x gJ4CZĂo1G01@vq#6Arma-b4MqigG 5j&zZ쪑%]&bpu+Pm27RoؑDkB]f9wP!&;,xST ZMŷdsMS ,afwm)4|4w۾z_l)ٯ937|HHp!!21,$lIpޝٝ9uO>qr #Dr"ťVWWZFwo>, z7MYD؟g(C0(C7ے&qym(7`\[ɉR"]s -}bc]*UJkXDF}0e,Ͽw7?S'y'9 xCoin wFjҚ k𦿧SuQ7_vSqCq]Ԇ`bK_Ũ5rRp:ްD TFݏ,]8wZk(%li00)<% qu]Yb3cc4c>Rz'O?z⻆u1y_sB<)BH, _G[D/h}}>S<ؾ},PW tn۶ ^&!={c.]=40x[` zᶷI,ˢиV Ay~:?sg _O!'ߏHQ+;O'‡S| GJoM2G <+C/*ښuAj1 6pNKYx :" "3WyuF5@N9x>OIZG^yRoxUeAg3jXaZOOl2+ٖC//=+SPw CH<=8ș.oUDb恋URا4)2?,tڕ?~wOЕahKǾ5mzН%,i{TI0C~RDYH;ClӾ|~n~&D=}J7"G TŸCyɟz%YcP ,gȌ)L0+nП=svBŒ! нpԉM*OgD<>3h.u~C!uLʪ\ա}Tΐǚؗxf[W]8Ж0*:reyup`p9#>}և>6>*CY2p8V8ZS8ktc%-8ѹOݣu;|0lc0V)Bhz;icM[^^^gю?~GoZ;w_o{[5Ip4k׮U0*#ܸqC<tX W~sqFdxqlؐE%Rrug-p~/Ȳ(I,KfeVӺ.L2,y &˜$YNCp+W|F)hjݚIy, x>K7$O<ފSde/|qrs6ȑC,u+*ܯγY6/yAэq bs,(/YEP N[UzuWS+Y=6btyޛuύuʊ,ea(Ife S͈RS@  oUu T'#ؑ@3_/߳ñW|KJ@ox  EJpOWT@~bLcL\DO}jeg !e,t|;%ZF7r,* G3#oF#zqO;M$ Eo_8zǎzxƔOl !-}lkcM mԆ{M umkkK)(wn];°Zӹ3'/{{, uq-Kd]F.6~)\<#·t[몬wa["W!~{+ܾKz]x}d쑉xoⷌgi/~(O ɓ`egyGW)Z7n~'Naaaig)$* :tQDRRRZZ2Ӟex΀2$u2*52Rg~痿:w2qʜ- b/?p\z~nqB!?|V[+QU.]*+%ʂ/ %Nxl'?0b@9x$N5h.=hL-DP\'B' V<<@\%yLzyG;}鏿F$w'`Az_4R̃3 ē'O@SNmhUiPzرZ-FGdj=VGSpȑBWE WZG~uj ]H4oyp@SӧOyl;΃.>>5|۷#@` ׯ#̙3Pa|?q̊NJDZ2Kt^TPϲm{g1޸*84=WUk=%b6;׮_q㋈; "Z,cNիl8tڍ,Z!v[kQTJVi2L3Ve4<%N"BAK7b$|x{s6[)-9e~& Lf]+HB ATށšW. {3‰ Bsbq2-i 0-h1f4ۘ15ktLs,'”x7‡;2\0wffnp|NV|]kտg7p-F6\ bGm-7~.xl\ 7meP=hAs6lZ xm 3o6d^q1޺;ٺ @;1l7F[kWĨ51h_ǟHs ![zcjkχ5WfxAkt &MŸV2G|ܴG-{w}{ aBZO6b_5#fZl ޛjMg&;Ψk 753o:#s9c=߂ûQw!&[]\stw>_i]/^l4|k?t>$ߋ/?޶j5P`i}Fy@nJs!B}*|Z5Aʨtah?__ Cȁxb|տ\fYL8M!Ju,~TgN5HLdq@CCxˊ/DU╖KT2]jU%+΃<&Y/+r#AVHڼ.׃%ލK%,\*W0RPYTĠbW%̂*E2)9- i$iP%T :ʜ8Ľ R9XfQeƼbA *>/"_=]a|:&wy+7[`^V+EYu`U.5P'iיwYלtZYzIԉkMKzq~;ѣG7ox< ~t:7]{ }< )̦On0oAlOd+bྒྷi;x(}}观yL8 ;r?<)2iAeQWiQD)³>g{&1F5[r%eYɪe)<roꀟVՅ$ #iā!&N{J\r]{Z:4:sgHŪ+2d) U֩SnY+rn{UusnEurJL84 eեdCE`UV#g3fa0IJשDCq$/n\mS19LD0tul&2q؍|GT=y&bl#7oHw a39=p(խgNѥA(h м*fEA\-ȅQH#&q,c[gYOS,t?_ޫ'_(*"ɶӢI]}օ .'R6nE ʺ8D݇P|~2?8Y `B8TpEZ~)ڰdvcԥaQİ$qړv ٩۬,zy~;ϟ?oZɓ'[EO)f $^~}+5~xME&6۷ls~1G)1fo_:Zh޼y3=~+AIvϼ-{~~:+ΊL&2UY]dx,2ZLhmL]5vͱu^`Ut 2\ E%/`U*H!1a.E E\ԅkTs>W%[IJ9M2>_+ DNufׅ$iK{i`*b:i䥑35[N p4 ,,Zv983ue+ܞed3Ij"BX0S-"C;(0C(6K7 |\ hl%NJXRZRXķw)mw0Ld)pP՟ַ"׈i<#Y`t MQ$~AtLж(o] Ka"E} 9]ۚ:c'%ug ǿ/0n֊>QJl1:2fmF@@W-<;CέfH+b=+ uuu6%I':m7?judv#ou'k-p'xrÖ69_53I>9l5n5 n>r-!Qo'46gmNHva_.`ďU&̅;{{{*>})Ḿ~>|wZo¿4!E~?ˇR A7ߩ;|vvvn^*/w޳g:˒<"3T$IPdQUuE|C뙥Ml^<ۜ~6B;84̿(VN0pU.օ(udPUuo. 7TZKe/]oj*WҾb9qWź mf,V*~RƷn M&Kn]B* Tn10,=Gg&.Pth)~ %%o*HˡF`,P{Oksb'.u䉥B% @ְ:.[9nGWuax1Xk9ڵ:+GJǖ<5css2af, 2GGX;*!0wykLW#]yv66G:0g[{3E:ʳĄW]X=l)U b 9Xue11"Nj]!<!ݻW^醜uW={OH&C^g'e;;;u;Ej_E^p|ARޕQ\޾}(!AUUU*8,yF,8mM[Jf Dʶ[FUu7UEeVif 8m2K.v v5{)uzM۰.#DgUUU%ijYS-sR޶n̈́%r5® zrZ%qI:`s\Gh`~~؇o2Tfx#3\89X\/cg18i\>,xh汛 {w" -e% ƃb<.y־9Fdơ'Į;or_LP&%g1b+O<8< "2 G>6M v fm5uJ%a# B,4_ ,ŷ֞v6eA´fړg=c52 s3=i F<Íԗ*:6ߔF겯,zXLƆ51=j꼯ȸChWVpk˾gڌ*"jơ841 }`vk91@ëqhGG(p@:+PS,~h0ۛ.[[Y|B)p^)Hi%6*s~ ʯ/dr} ֭[y$p]\c~sۛ7o޽{ƍJ>,XJ9|ѰHb?,rֽBhO>}G}{C.a]$0/>yfW51 #%g}f,4.*yK`LYӲH ]_*?z1Nk;ݱ,M&<Ӻ䙓eNuyhSus| E{Pt]yu*-cX.Zw%VH/KN"@4(.~Sŝ&4nr13L*+Ffj`UĤN"E9 1+$!EC7aeT6s^ʂW6u4 xaP7p Hqci?\:X|+]q|n䚱cENZiE@1kIi{E'NLF XsȦ6*kE6.aV7`"#"yagXl'ա%{kWW"m4Pg`-h<NX϶ 2dGStH0wKm=ga=hW }^{}Y@:^!QM92#]$ d`e %rBLѨZb3bTeV ]}I8 \i͘)[ˑ<lܯ. 1q S 7еDKհEhMg h#cBݣx9n>4Ohki10@ W},m`A[޹so޼J 5~ 5޻wF+ݿٯAI8|n{1 _S: W^-ŋu 'O`X ^O]}"/ݻp/[i}6x"Oj!8ZfiYؑ(3Q$f(!i:umrly[JephV[ƵH OG 1)C#M釚c|SEMӰ+T"n -aLU3- *CȂ2yPyTb9YcF' O̭_s[H@k2,JC`S^z~ 6`ebWv{OsK,[$\)%QCg*V"SɩMIURW1,}s^ҶM5ӗ:9&m&iSOx#zu௪Daym CaU yXM׻A(XIAPGZ 6s8LYߐ&rl* tßogh>|={9H7nx .\tBK.\ō V.s%w%+pBE .TL뫤u^ 433gHͣG6sp޽0 /?F~ ]ߺu FJee}ȼl9y;vzJ/u}ᤆ}]1 'O\[W7u|*xG?;*MSKߴv~<LALu*4R)ϙPGMk0OOBWIyVK^Qfe ,eVdqU]Ektv O9"k84C*I aLBh-,,ӠTx[DR w"q5DwKdXP>I׀qEh"6|؀c1nmۙ lݘ M;h/W*Hbc2!]q501b1z07u?MAqgt'FB X3`%zͪgDs ؠT8JRmN{T V^c܅1s:ٝ>lc7u|x0:ܮͫw4g4:&~0nv_oww6 ё+CMMA}@7;8*h}`L6hCc56i.hM{5ojƝ_ ξ$WL-l gϞ}*٠k_>|-߿Ưx߷yoφaPK-|ΆRͣϟgeծ(HN%OS.9Kyr3D"X  ۸Z]'E-3,b{IdS.=\<EiXzm06[Q_@rX<s#hMr59{ ʸLVCWYPW&'`|Z˜O#8a|ҀqZh'~c:lmV#epp/ЦgqK: uHb'=":;j0`Z]fFd{F§DGqiԂզ_[WSZ,L{ Klh?[N۳sXh8V:>B#c?=q oiikZ W0s! WqiO8_ꧭwݻw 68 p7o=f=_z[. 3@q>HHv2pۑmN}8S#,=V-XJNN[u>an?M> ʣ|d!d+Vƕp ffǵ1t{=龬ódq4ޗGSH+k - Y@nh oZ4Jk8)!ꏅ@d|܆1 K հ)|~6/dqM6U,$vܫ2oam>`Ii2%fLƬ4vy{: Md`&n ςO=I,p-7K؁-pu4@}bB҈B3j# LJ:LNfVxf:Ih[ tF7=H]KѓN6eZtpt<蚊GtW"GK\= x``$Iφ"Bg:3tmϔ]FbGoCԑN-uʌi\et1A LI(8>0o Iax<gkֶd}20+9>OND03`LЖZH >zt!2Dzl '6cc: Y$LSА'ugҹԳ6t>6Ÿׅ>(:VgjpAMVvi.zwNO9ܮLsr%sӍօ. 4h# q{mc Yy(lFgϞ麾^ADŋ>|>]E;C\|VhKW7ZĻw =Jamc_s)(fuGI֤9YsA2OšZ Vi aU&«roU@rYUi*8OVU#~ o߾?eYbW^ѷP}!>xٳgyn7?~RBsWWeRWIeUԩh*<3el m IL:>dRu_Ƕ:)slٱa&GY[GI7{~u}qس)ⶦUMXaF3[Q[DEU%Jy UY)rVw󨭀jsdpJ P]gQ-qYr0LC!4 r"S ?nI cH؅!ی4IؤpQ/`#dF5!v"A"'G \#L<}j$=#tؖ Oq u6(2nᾀ#ծ:qۇ$b8v: C[ qM:1־z r p{/$% ֞+_CXp}康jb=@jG[]`+'h;}ʻ%܎z)pRwh`SLe1p.Mn~ owڇx2PQ6ƞ_n&]5JyuxXOmuvΥϑU_]$=z^*gl.^ <#/#ޛE.TJ2D>zkލ}mՏϗOWt?߿=ŷx-`WӴ;w<}W_g`kM/6s|5?{ǰM6~Fs vU«EVyā,ֵ(D̥C-57Pt%Mv3"2DTh%7t_Rt_R"}Bm6@oV%qT<}xU[ YUHiXpRp?< lgؤJQɫ(%XqxS h Enƽ\Pq%5P8;).bل%<>ͤL |= 8DI(a{pJIAFvwG?@: $ G#8D@=Pյ׫z߾՘pF@H`,fƚIrЫS{}Tw} vl)&1E[c=CYߖ!,p}x4=[WO窑Gihӑ\*pܛyZjdkE,0z_Xh%ĐK;"%Oޠı)e[I U]>hp ED`uv,ӱHgr|Mb ̺,&G'eS~Ԣ_1-RZ'N;\OnxŽ[<,&P,@. v X|ƒX؂zX)`gq&'%ZʴNi q O`*;9x=$1 Na]H'0yEyޡc1^]@i;`sC8 2ceOz 1 (I%N02Ay9RxwE)?~|~cܾ}M<|жC,o޼ݻ~ׯ_cϱ_^~/(>::&<~֭[(޽c{66K2$.?:K"Tɺηu&4DC :bklf5ŦuBoVfEրwS` lwvmjКˁ8^t)GCym[bSL<bG'qS0S@Zx4(h[v}iqA=m;==i=$-d@YtmZ^Vv)Qq#mu<?'>Ŷ82s;.5d{. X*O;<}@~d b,}z &]!ܸqJ,LJprf޿իW$.@v ?^\UUKF بy˗/^ť~x[UE]gu]yTuu󺆫:Nb%ϐ|]]L}ѷg|q^o*ݬ*ۮmr wfԀ1̼-g_glP~ _mU3. $ޭR|ܯpyk3Ȏ˹vnsrHK>ެpK\AۡWdU* <="FIV"'ZIGN5NPvϑ*j',#LIV(.RPLئmm˜):K+) l2M!L8jƎ' F@t0DH| L5p#A5 -Z^3#"p=5:vš̆sϬB)RWsm18SGM%9G^jT#@a^T}U0xS)DZBYہlA`tYWܸ 4U}*=\_P3jh9Q99+ \)頞W<Ciޗ{ ;fMn]C 7ܸ +,]c:COIsu{K3 ŋsoMTM\Ȳ2ŏ?~TWh]E ZETWvUb_:/(]S_:RYa Gy+kry)lwUetD3$?6iɲ>oMr57,IU|O=Eyq(ڦu񱍎uplö kHx5&k i*>4@x,9L/m P Eup܇gsfFmpwn;WsvN@&m$v#![.}b p;+R28q$aD$ZNtdP4Һ8 HN̐E`NdxvVihٲon|]sTJv$pM#/zl</ -\"ٳ8ibՁG'.m$tgQFN95:l20qNauS Y:2v9FWK a׎#pp݌PB|; ##Hq۱r-WL9H<~=(;l `*)Wf7 $|fԕSdbrZa0e"ZwZ9'Ehݥs; 7B_]LcIƑ XO v4VKv-)p1B[ ,vmcnI솮Wb Z# 0N YƴihzFyh8ۡƖ8JEba%n^* ZZcŶ[;_]ѹ€Jg2l$rVXS. DdstQ)>aٌ[՘[H$K˧XZ݉Boglo:Df()~F_ތ$v3UuRCsidU ~xYefJ6bZ82P3Ҥ v O0Cԩv[DVqD!ku,%([6`o N&0[k)šs=CqM90UD0* :&ҥG&y{G>- ۧؕg2A3<-ƊZhFDzGGGL9D|e֕h͖c i\dn?U;gP+4+0n {0* x,m';/36erLby&D8SXzdBv!6(h !V27r`j~&v_#X;Sf(cAcq=b5zos]tB%tǎE!N ̀c !. qq MT~Kcԅ>mist4_4}w9x<^^~lY?~u_xq޵e+ZO7|rr_#|_:NdiS`BBG }v\ejԹս}!$7 qH+l#|mο-qv|7!2.d*Xȶm]9+(9oK ,8ҷ^ēi I1/}uח=L}6qWh }˻.۷뾸K̾IץE+nfߐI(ZC{B8uET[|<Ԍmf%Z*JU3tmfF4y3BB8-uH&i4wRHkI+T"H>*hZs&'"< %*A_`lKWYCY*C,asjmהYs`yC,Hf{`14K"{>%$ő d i1?r ]LEm%6{; mT8);k *1?EGEw}8{Ǐ_xqO~) =|K煻Gix=—/nvO9'sSmSm `9+9r"gioW=\v9X5GB 7[Z1^+hg1…sxnt=uPf< $bdBYacS so 4䃫 0ˡmGEc%ō'm\XOL`km'j9,[0왋@Su@2Z݀A3k8āe5qW3*x&v1\-Xkgc! X:A8n`-elkC ^Oׯ_߹sٳg߻jpt:}LjT{7d>|Z>}wޓ'Op j?9Deobf.n*^\ZySIp.,1V)RD<5h-.{`}yuY.d_}}wj_]tվ)Ye. Bp5 ]6i[2(*صv[К5 yRKʴ(" t+i)ĉ%gӶHgD.ԯy[ ,H-79DaRr,8x"P5+jh-+nOR,͠ slbgr7U1?%|!<,] ' aM19 ԧ$J4JBNc-$V's$vh hyĉ'l[&Qlyģ[Hw'M}+v-r4`/gzmc[o]߀%;WʴHhc8؋cmtmQ]߮foֶqNefGld/h |b/˱kp5z_:nkW_ ~y?K..nĀxFitQ$")7W]f80.\qb 'lG":Z*UuG84g.7?h?i|eA׏=ڳϟ w#4p84 NC/WW5f-Z\٬X EX1Șxsג1cM$iSUMܞhs[tW* ` cT4HC[:=! DWO9‘,-Ŷ`cP_:mLV1 # | +ޖJ^a)!~T5*6[p Fdz1#)DQ_0jφ-2 VDm؝vHm%VcC"f+T-i_ LuRƺ2JS[O&a{b).4aMKq`\᧑K 4yE7+pūW~hQ׷nR3<~2Q߽{ɓ'׿aӧFn%~܌?EVEysd[5O6hq3oe,EWzz 3]Gֶu]sJHLҁu!u#CTQOn K13cۜ2* n5&r<n}9YccZ.AC{L!c?VEcSXt$6j CoO1Z@ @еq#y1Jwi!~C徥}r_džUS{}5tg,Mi MsF6FzocGz6@ 7*[9\z9oۮVrh-5ֿKppyf__pb{{{֯n_?~xxxUߧR}5~$t]}ݮwoO5<ۂUVUYYLSƶEZWEBc5<\9\FOwO,n>ѶmCg; oonkZWt]f "3X3^9)qh•~] J3]`ThY₣5weTm›xGnl,6 Yv{1x2sggi af,HQ*2t#^p䘘L,a0N(@Iڳ5]:t{?Jcː`*X&<_RAkL "=X0 - Xԃ$tYi`2!6#a)N+iFBy씉"7o%Z#(6E`EP&YGYj^+9մɐf4ЁF XI[tIK Z2wgeВN㖆@:/i܈5FK?_v\Uƺ󎠵ZMEVbVUӓ*EZn)j`V{k+Io]BJ)"в)k0G!"'4Ձ>CBBL~Q ,}348GеNmul+S=}s 5:ї"6ӿ]޾}7o>~sU7oܸqÇߐ x{ٳkCE[n[\{5$D}Ν{ݽ{?}x'O>|pU_O%%y$,U^UEEiIAYPJoq".H'޶U(MrӺ KT 00AC3 tԪI{R&vol3f!gYE2{G[8s;`9 bͺ 6fv ADYE*YeIEc<-R=OPIKe-Ґ焧 QN<ȟ6[!%xPK}}GR_7Sn߾+E`usM,y"+Akd*O4lS^iIܲLX~E]늜촦%Yj]e޶iEj4ζlǎ~yf,VbQXO(Rd' e:qƬ#?nsy`_ۂOq>ڗۋYp>^|`O}o ^qGM eF6S(\LZ Кk\e`1ۛs@{ c9]M`ۂL\8VYFˎ|O@.vlmd:wj~cJ<[r}SX7 S48%ܣ:#5ŵm(6/jmooܺukkk7y۷>|o߹s?{'|`V4EQ`/y߯?ٗ xߌn~?r'>t)42yx]/z⢈(n_EM!+ہq((Ȝ7X*wi/a^26:iН. qYh,CȜ3exA (Yh r܀4n+|iuB23zHc/b7=Rg.ڙo!|,rhYB6h=SW o˩ &Ӿt!^XWuHwV/+ 3$(Yi!AS TWKs Suc }u؆WqΖmo`Ь5PLWeM>51jZticU7n_Gb]TSש1ckhcNݶCpR@W-č)Zȷ[}O % ]+_&9Y#$#y -"&LjHuȑp8MaYvc7z@].//(xbɱosƛ:?~!u6d@˻D<ݔ:sVqYӪHrYg,-K;V _seM|XWyq/F$۰b#6Mu<%Ze&d$:8**`]喻9Pfg -623u rikȖ˥_m*aȄs2 6d`4L/SژRRs jg)݅r(,.O@3>ᜭw vx}Jla`DE/BR/,# WL-cA!hS[W]4 B#?Gud,g{-B4t3BڑΑAg@ge y$-\=Ca,g=9CDG/KMim=;_ i^$ \ B]R:I;Z%mRZQMXU:?F|;j$hOrm VWzvFFWk{ fN:kQ *:u F[@N ꤍX~DϱM\,=GJD = _aPɜ081>^ JE*bRrq __On޽=zt۷oc7nܸ{ċӧ߿uA <߼ys֭f7od"ʤ(S^)rě,)sq"ZQkx3@k]Sp7K$EQÝjYZ\MnĺUʛ"jj3Cu1lb$)\O$uU 2uKb8n*r>]9`yVx&Mu&‡Q!aBiu)A°e,|.e ! p.(5"۹'+Hc!d" /rq!X =3Zj`*Y.]>:WzʜB>Hʼ"G+9=m;mA݅s=s1[C=uԅQ䰍{p,J.q{qUkJJUR0:CxlŞ%i{wA)h.'+ꙄU,5}sړD´ k qA:ꧽJ{'4 3r3=~o8=o:W'r90<>@ I]eKz> Z9\+/{/ăձ hcճC}NG> b-2ۛoSFYw=n޼5wއHj!_^ޯ/sg gϞ}wc78yTT( ] ^򘦈3ZSS,}yK+ETW~oy—y%Ɇ ò NkuᮺDM):Pn Ve^UzUȑ`e4qą $LRk9 rL2qduV8Axpd%8e{tֶn˷3s`%` X6!$ dFe3M4r,~<EqN:&4hh®9A,؎#;OJʘ 8 i5n $зf}B؜y؎E&"'FNm=ٴx=9o>r8X塓ɩW֑&񌘸xN"R$2ϠČK`TL6q=s8#8mz^Ď+fL)~zʂFi*Pjj[qT\,y,@/̻⤭jf2[Ҥ!M[*bR``ظVYY[:*?X[`@ZruL4icqYrL*ߕyH+[wJ: p6,Z s،}lc!t$Ap..smiڄyE"bGYϭ'GGwzrWrab|,E`\۞W(,>ίX-T\żϊZMe,&XS޿cg+h퇷?p@⫆ ؘeOOOh\|K09w{lW@]^|}{F_"|!\r||C7.n~. B:4sJE Z+QS})X::#{ n6dSUWsR^A55**“ n , :*3ʝrt*A254h}\/KkKКin5IR#O"7R.xÄANS3l̈́Akwycf in]nU@,%6D F%n\p]G~X eF[lȊC;z0\Sk1N*5uS_Ί:z/V/}xP{b$N| b&l#$I}0AZ3*YE'!؆8,]g+)vW${$pLPV.4%mm%u]G4d&68 3Bȳ6?*s)tؔf¼ݭh=k.MaRZcxmufݡ 62.fpx-V"ה6hCfYK|vݿbB@猒"\R;aEuT1.결RE['Ċ<}GrTy+3I7LPL2s6e&;٤fW𓊞Tl\"9`ڪՙw~I*6?q7rhYj噕^ϤJH8IfP WHu_qcy'P /H 4@k0^P4őE#wZ&&'Q᳢YR˩uH&U-p2_U\*q6@LM) -0?P};\.BSj]g8*cD~遯ϔb!P/-G,5 2`^[V)OL l3#UP`>l/f%\]+i>zbP<ܗ[l l_>wZ\W:1ľA=4&OfYa>2*c\Ґњ;Lk(dzQ.ra2/,TW9\[x?n.N jp}|G5'& :HXwBbyK.O@bv?8ue1v &GZƘksFklRFr/Evvvvڵׯo^a]ti뷟~͛7_ǹwիWaݺagg~:q<!!>!@H@ Ͳ/rnwݷ{U_mò+Ȟ Ia؝rduWUݒ+}޿ƍׯ0ou}-۶?ݟb_Em|Kd>x_оKݻ" !< Efi\$I'>3zԦu(Kwa*ܫ0YY:guWYemlkD*GEbJ:weM* zge<(sh9(8+sEerB댻rni~D  pGiš-bPt ];<&yF>8m&P c8zL2yBN"'M\N(BZ]sЍY| {./OlǍủn87Wc]qpu`Ci`H*&[>z0 {v0fxZ8XŶD`+5w3&:ԑ96{ Rb{1 Di$k+NSumtIo2ST a LZÖDMOAçTZYg1=Qi=mThU&qg1/m= `-B2kGO'ʸ%*<46.瘷`6=EP1aC6[E]7>72C@Ioޏ8Y`TDEhw \c"yK)z{ڡ<}r=Kwޯ=A(ߡF^^z07i^vmi7n޼4P˗f~ӻ*,D0M}r+D'<Kmkᬵ_um[NbrϷ qߒ& \Q&yM_\MM.lwebr/+$NtQvɝRX < G| +"{>gH9I0gl)v$J= a 隣 #;MeA g2+evY ZOU^-ϧ~H&&;oiղpEJ?v ^(E !['M{4lCڈ1v9VRJxV5sאoNH 4\mTK=m:rF ҄خЩ|6?CU}? , @ ?ˣִiSN L&uR<@hqk)wMo>[X Ve}SE&ommdizk+RKlDuz!}5s[ؐϚE{6|Tcx8S MPdJp 6?._ѡ@W^A\GGGO~?޹s+W<}1ǰB~ݻwqͩs5~5ׯ%I 5q)]ڡ?U".EIBym!ve)HZR*bgW'i@/I`b*8MFޖI]h W}n$`袎/j7!s!r iԫ.M9#ZW&gP4H.Ү̲ q ̗!v꽖,@~}v{uSDkfBΔEv9RЋZ4i ̌ XJ\KV=o@kیU9UnjFq䤱ϣ ёQRU3n&M+Ʈ߈ȉ}}2sS`v@}yNCu]"y˔-ogl&[ѥp2]vA|Q&6%6Ξ` :JShD!^6Ѻ*!܂P(\mȽ^W=揄~qEXC>YTd)mR4-l`%D]KY@ saYG>kx6 cQʺBj$dMu`*CSF2\3=C!lgtT1?#tmVαYy^zqK? ?~/LܭVKݺ(w;)`,^3F^$Q Lҁ ԩ" 4N[j@>綼qG1ޤJ381e(ƖV΂--pZ+9|E8iG!_``ǹBzh4fg޽ǻҟ^_"o +Y]L FuY쪁9 <הB[Y[+8oГ2n*v 7顣ol]wg.zGw-C \ rw'}C1}鮡ZzShdz&-Wt28hv܃e\%T7hHqMwuZWgJNA9W4p10_3$QT\p4 UXC=Uω;8uEhSJa-Bwlvt:yWcF`ےcc8E<4幫.-2*”-?\ґWzoS>=ܓ'O>|ٳ_O>~:| /Gӧ=95g^]eTbz$G-cTi9 ,ȩ 7%i #X˨_fŋKɌ\!JB=E>I9Q_$AABS`c@$n,E K<75:[$wWah覱 f37ط$ vXrO'f;W*. ^*Pn.@h"\ѯ~7qs&ݜK +tq0HZ~Bu;ք1/`c jl2Z`W| #E8pX̷%_ElUԭ̝oS5ĔNJt)v(׶t$~~}E8}!D;`իW/^x/l֧OF^x|']?>$I4 ڔYS%!I[$k@mŒngzzÒ۞mShk3 ܦ&{oM.`n˴)A`nemCw B> + *~~ "iYX0tʸEVWP'Pt< 4hai*9  |5*iS*F 䎳ԁS5NqM'uXH#{8|6oicTxvC^; \T3:@P:IA:zcҲsfhY`eC(4BτYz@xFkjеmM: 44#O)Vp F, ifJ3[yڑ3HU] Riu1 H,.h8?go˯>˖CRr|C5h o˫38\iTo.i| cv"G=Rl@@eso0;VGL ȼW7%xB@!CBB> ^l=njWu=]@6%p@dF.wtԪ>Su[j|=hfyO/o. ZYOeXKx_*04rW򙆽{G :ųH'tjBڝ<`+MOlOzx }dL?aLO8(Cvm׾g]=zݿooݻwݬpuÇ[|ٳg{z<k?=:,3кLO*3ݕ KncFW۰{Uo[vM6mږ:lsEQ[@uSyu5uZw8r_к Pq Zgs7N&,jH +eV*"󐧀v:uT0|挤% _e"kO4xҮ8C1?4qpeWx?aPk/hqDQ+,"0sLV"B+ $A>i'\+d;u͔:%%y@[E*BLKySnj#hzcrU-zu(#'$ԃbOLb Z>+egN 3;%r&0r`ɾP[\ͷUtnKgő>SASt) | Bzq TtڗG,9+X(H'Z6-2kYJS?@>Y""İcȈ$L;uwQɡ>LNc +l9xD FX ű*=Qv+ Ww* d2hsQWbѮ~G>2:FSSa`)`!e|㥉PLdܞ8δ@8D_IC[s]k9:4$Oq0%qDgq K` -yh"$j쿢]۵۾|9ۻwx>/]'{ ۃ0?|{{ۛ/^)wm׾7E6ϊ,.ˤ2O.b[UYIQDY,k^f7[CޮS(.`{пMzͮ՚U\ldW_]5oTi+6m7i[㶂y 'g-]E Fg;hnJ$iYF@rSm%8c>V1<_WIx,pKac7Y`iq70 x33x3;g+;`6n,,ydfn!YA,te7VZ#E`yd$ޥmuǣc ==I-J Ƴ$07D#~8ꁻ }b)1QU$Loʑ&_u@o%2$ sȓgv O(INH>TٺXZֈgԎϺ>jQھkHs N_ D=Ф<7tm.bwBoU'6X C].>;R&Qr'l/f$xJszƆ42>]u钣~~ui}$yuݳ/F٣Gx?U횦ϙ'O<|mpuZl]+WWUTbW)7sTSqG== -pKϚ'7bN*+?Yr&oW~q{^uW(A{Vl=:ݢ\7 T ? l:D@ mUVˏ __AS~f:jU,Z-C خhbtaB0@4M}9xqpj3V!ZIu\ tA(/3bZNJwĐgW',e ܇u"b 6]:=#"!,1!<Љ֑&̌Hecc ,v0R>+ CF`I1Cs_YWkI} }AN:_Ma Kxtiƀ(8Jti b:wݶ^u 2ڼR?bPF1"Yϔ2 g Cs3=_ҹ) —Wm[ W4NvnNC6z$ŅAйg*܃{k9yyKzujhMQWPggi *#\%>&k@ ˑ&Bn:>4h^h}Z?ݻw߿uwmI>ײ/_<~޽{_C#߾}?{˗|>}?N뛬|}]BѠh $}S]y] i.1]]FUpf˾!ee][,ݶ>lVW d v 9Wuqup^*WuWbwY[ڮR(B[:6l½udu:Ѥb2*j`V!<\Z#]5>"FZ|*gEF&E̱) )8e"LC^%o:@0; ;puxn$4s/[AK22ܯd:I#b&3`čVY;@7:d`))p}#jih'7 -4DĠu]r3gwτ硵ґ %lL?ytc(@XЎZ]>_^l[*÷G!pӮryκ&KT&iʤ2~xuYp5k"9#o/03mHbv&!dxzꬃ.erQ #Z{zȽAKˑMW~~WtZ֛7o}Zi}ۯT"jE]y]e "L/ESf gʶ!;Ľy]d֢V k*Nzm67NMKUME)*٬&46TIS  e5%ж 9"nO~O`,h%U9/-J&gM“eF$R'K]< ?"xP%R0|M"<y؅_Љ1LTEGN+B/Gm6"ZI\=;x"rĜv% p.hM;v5KMNչ;4V19+tMfM@IsfIٯs6, z?C?:t00זHd {#{%{a77j`&q t;AhVW:]ؖhIλ&o낭q@xmrau)`N7rGYdyzVsl %yAKxxX$3G9ȹgupmֿ`L\LSvNe*27{ks`3G6~H (%iQտ3\#GJmE^:FNh22E^@a_\Q`PATLUa ]i36dS ld[%XYЏ YGSBDžDVV1.VYj@׳S=sqwwwzzzrry ^zo?m@{~h4ςֆaVzI~rAS05 "9ҁKTVGvnGʒ mp(ݮ;d}Y6\mȼ!;dJ%18Vm+}2@چWF;=[ -%vCmgF^wڎ#;f$n9mT߳M|-q孎Uy\-5O0!a[ #K"AfoF> 2L圮|z'%W1Tm @ טg] &Z~j΁gbW TΙ]c`kl%0& fs0 e 2glo@݅SV@p^"h md IjyVi"^cZ3Wc$y&k,3)UAe H*[50KG4u56$a(OSh:PHWuDSeUZeʲʐy0l?Ev|Ǐ=޾}7̗elkǻwGC~QzxhmǞCh$Ja;־m*g.Pn[c!Ʈ0Tԛ00x'鰟d`:F4StӴm,Ƴvu55-ra氯}5{1B{Z7I%ߌq&naŁ փ?ֱľ r{ W}Ohj6*d3Z6l$C3 dn8 nG#t p:kµMwf[* Gx𰦫:Z`!3BԞ}WGF-Jx7f__au.ۛ/0;6_>Ǜvvn_10=f_+~lz^oדz]7~=;lP|r]Mqݯ678-'xvv9IqG2׋h9,Xej]ݬr^\o7A 5 SٯЦ.P"X,JTP})DDpA_*"}*z6ijڦiNZ-(8i3Uiڴ^?xk'{AY7YzEQ\u҃S{[ר^Jmu]JSq;ښ[:Nd:ngc}mR\Ze3{vyUm{j<.%cJ2/v66ҭZZHHxPj:{8}SN|+VRx2Q)jE{6o+.\*1pZnT . IgU:-e5%+ J}ui6X59 Rg7 ZMMjjp~E:kQeWIeo7:%*äwZ|G&ǨhώRIVm1H$(pf\*/zU$i.)ަwʩЪFr&7yY.1zI2K,3!f[tB'3cC9-ejr^&9zk-/I3CH\2W\7>]U5KpZ͕"ya)/Ub6+hUSV[>KRpNE@j|>G'f[TJ|ysss%=w>|8??{_MGGG8.` KFӂH(G7VF:[D %շj<~ Z(%Ũ/Q$5I~-ޕѺ }݆iXZ:DH}6z{0صnnc-=(p I0]KL(&`|^]x?Hr .Iy:߯}Ovoko`b.xغ=hiXon5$ԟpKR/9ٳg5jTAA Re---.DL&SvvvZZ… O:eZkFcaaY233Ϟ=R]5gkmmMu={Ȧ-[$Օ@ BBggggv1cF^^ɓ'={ё2&wfze &J:穮˗/qƷo&'L &XMRq Tﵴ{x^x׾n-**:Ӎ_|+޽{?uj ?k.Z~d)?ʼN8̙3uFFƅ Z#UdCeX$_o$ݻ6=ztro,Xpҥ^?v^Μ9sС: >|/^ ɷ?~ܹ6lĉ"Rg^^Vsz͑rM$#@]G!8|>|y&rNϟ?+qf|ynWWW_vM?~ ;vɓ l"ȢEa޼yzu޽ۻw{";Çˏ]|wر͛7߿{ߑB{kҤI+3g /ҝ;wo}˖-riʔ);v(((8r7m4zhˋ|I\ݺu/o%۷nj}ϟ sn\9rdNNΊ>]ѣGZ^/YDn>}Ν;tڰa<f?ɓ')Bz555NS . Btʕ۶m_PEܵkWFFF^z51ӧK.|_TT#%%%p?h[իWO:U^=zǂZ˦~F:~!C$Av[:Ge=#FroDIH%a8VE#40!;P1PK=1TBǑIδ絮=Mb>|^S\RR P%h(>>]v)Νڵk۶m)`i߿;СCZ??~t'O%RRR ~4 ftRsǵkEϞ=srr윜Fڿ?K )UTT@BJ'JI $AКd0R69 wanݚv*@ڴi +V)2W^RRQ7" ]S(VZߗ-[s1000<<|РA222McǎDTgj ׯ.]0azC(Ҟ˛1\pC_~ 좢4 J30#2?NzU֮]K]v߾}kͲL3f~&J!!!?>eܐVE!Sb߿?G{'5;KbAk%CFg ={hgϞ͛776ZxϏŅK ;^zEsppشiuhnnn{ơÇK=qi :)9RhMMF2h zBt o[{.#GՁ޽3[a,Vkhт8emx n$ATNNN(Ssl2U4yqtȑ1J5< c%ѺlT!m :6>>)'Oi Wll,+R#w1?z͔RĢQ,Y俹h?))Q ,_Gõf5CIpf#<--M"Gk" ?]Ν;/ӤIج.]:uhIIIH;n84ZS)SLa1cRf?pUWi_ֶʕ+U|&B)3K53dT1lj0.^Z<¹P Zw޽_~Lm5jٲ͛řjoo/5m4)PB˖-pΝ*ϟ'91..N"Z7飵'H"b_XXH] TX2u: 5Buuպuk|P"H@F"kК Cn.^(Hš/$I޽j!ZOZZZuWܦMZ _~sTSⲳZY$0i";v,YW޹s'~Smv+oP]Em:?HjѺhѢſ4jҤɰaToՊ0zh֬Y76j@ɇ '3FaXwZ?}t>}VEdNHHhJIIQ~cxx8߈:ʝ2$++b 1sL1gΜ,s^z5i֩S c؀(N'VUUj2bElӈ#?;tЪU+Rh޽ݻw' $Q||< 6l>~X%r^߿/m۶5kO:7Zb=<k<&$Um>ڮGDjTZSv6ڠ5rm\zBkGJJJb nĀ>UVIbӦM"i[[l9u _|i~~~|uPhxb,,,3gfD۷|ҥK}||~H/_N.Y5h၇UFHɉ:5INIu릵QI;vܘ!u-FzBkd0$XEK A8⊷EP7;lj@\6~Stt4_2A߿HTTL<۷QIF3]tOOO׹n=ZB~YxcccTj@U5M&ŋ%l6ۃB% ǯ8/7o.4upڵ$ljF_ֹs7<\\Iooƍ_|Y3v…r uD7;wt  2tC-s&K6}U 9sF2ݻw?GfZ/Y 䆆Ns/YĞ"۷oqvP3 0NKKShЯ[EPtJ']'uIەK ]RR8Myzza_|}} ʐaÆIZYRК?\~}„ <#FQtt4 H$'' 0 bݻS$Y'.]J&(߿z*11?|iӦ&MR Yg>bnݺcrƎΨ;a||<~nц?yEEkzUE**OT6<uRiO;?BVN [DYDC*3!;9%AkD!2}R *L! pJ`!˖-􏕙ɷO+qr_~lfSR؆Y':TGec~"ALK2gʔ)iPUe֬Yd,u*X!̐1cܽ{W37ofϞP^ ȣiJ%'иڵk֋ %i+'W[~ y1OĠ>HDaADIIH>"H>- 7$&L߻.3;鞋=x<_;fv7sρOQ׽8 RXlBṇ]'U Ϻܚ6hy+qJdR's6l؀; [lA,V–򧦦 3>^[]>N0ŋ/|sJ˗ 늖^Lp¦M}}|n;||EgΜY`t~)8؊x*>?&ø1DѣG~׺G 34~{ Jkq26ٳgn Mrn$ڵk-˚'ƨy8Ao۷ܹsXݻwg+<,}e >_rexxw:p FO>'W^EsׯGs;=^v~>ы3-+mgϞ'Nyi׭[?b]>իWg|'*b3xc544^8a^~7ݻ͛sBWů㥫"pA2!믿W^Zr;~_~Y|gfsWzP,?{ 7ڠ_T!u?`h?iV[10P/rHYt)'OBP2'&&v?w8vp"Aռf͚ 6@Ee}뭷p>{۷o/z?;w,Yҍ ޽{p. s]|Ǩt1ҺʶmN:5oFswܹK/aN~o544;NcV rwG4w}zǯ](~?o@#b)aLMM Ҡ!v,"9IҺƒ'Oϟ1 >||pС7n`駧hx1p-曑]&LU,xo05k }'Oy'?iOx^ηsSjJsNaQcXToQRDq\c8a X,m $q6i3NI6R4m#<&g=SqTIi'I;I^NlS̶@5ڭfEvV4 D4gLEȴeΖ!S6u~BT%rڞ)RͶRȢvudZɌILhfLmM]+5D7hVɓ& 2fH'&cHduV8ד8jaI5{#GFa3ZpwGM?y\}O\m#oMfڦcw,|6reV޳ ϶\]6v#_1g ?[ +}_^y2/p^ D dQ"gEKRNJIiAN\堨0AR:cJeɰTʥdX 'QLrE+QUɲj^Ց*qL9k'WzVC*kFF5ԪqUø6Z5ja\ bF'2QY#i ,]kIQG4RQXGQB*$~ 'qmUVAJ!h(dMڪB)J +'d\-+CWJqTWW&b544~ȤuCN3|y1h $3n0f2g$ ='RCH/M<9ry d ͤ4Ӣ"i63alCL㓴-hW@Z͊R$ȅRș樐-ZFQfdDʋ\PZ-~իΐҦi)d-B˂?ȪR:Y3#O Ӽ) M] _(&,*Anm]-hiLML4k㙤}*̀њ20]CuM;As΄BEO0wwMw8n#a+m٢$u۶= 7$/ l(bE+ڮѯ_3Z]<UYQ`0cҪҜ*:/2Fi_ Kq^qeZ'mZE?C\x٦:_'/`/ub,z:K<3Sh kb\9osNoKg.džgmN8[c㷟?o롣ĴI}#&8ȞvgT\baTJ%\n$4yea"vhfØE0M,)N`j$x"8}eq_(qOS @$&9casrr:giDt@LRhE1lwpS݀C mzݵp{,Zz]߿F9qͣǓ˷ޅ&Go]Ó(nu=㈭˺]Mzmne\z>_ϗ~_6r\;57h4y>qz{ FhR0v4y|>vz~DؓMa'0Ufl },]T@HN%>\H c{em}MaA${ThրF5@i᝶o Љ^9=5NE@FݲD#<V S%]3,<0xz^+P\Dzx&ijy 3e~ZL֥0:e~4]rAemy˶y݉u ‹DnWƆǶQ>0wjIK^a_Sj)G(^JI|kS5͗hu4PaRR|0T:O %V/[by4kuj4ˠBFAfHh>rY<\ژ~.&bĕ6MX?ac^>U>tvr40̽@]I:1j$O4 JsF- Lp6Es.L R|:u+f/n n׵"yM#OW}A\ЀؕC``#Ҟh7W&0lDliG&̧_}V("Pi"gWbg3p2#O+/z%]6&xv}m#/Cܔ#(&џ` `kd Z~*t>h-jo@k:H.ciG/h1`= i2c0yM^Q*d&!7Ed rK~:K52{cןھ42BWs\P7巴u^g,x-,03Wqu=OM.dRiy,[PP(yΆ9S8aR|_g*6YUF^/BD{6$e[2B^6X`@QO`C'3\ٖkqH-ޟ! 'Xw/v sukOCskiƶQm];PO8W?SݒBT=E(Cuf"Cy)T 3r=NP}f^."}-*̾ MȰ3R~n TVu3(i_wㆻW~ aK3/Q[4n BЗ92ݸ]0(92b1M ,_6]> SE/!` F݌Ww*%p5]ň&Xhh3垂 xЂ.WMK}ZbЉ[[8dZ.iĸoKy|VCVPҤOv*d"rf1$Y\»LфEZ.*,)/Ů1IgK DN3ޗrecA9WzH]qT Z|xd5ٿ[^@f!dID<]]XnoB (y`+V#Ϯ9]r_H ִ;/Noh9DkWUqB|B>_tCh}ܷY_@y{Hy_h˓49Dݏ!>*r_hqTEo4TɇBl4ZEj,UG]{Ha%8>C>~N;hɃ*(0M x>̱4apSEH s○FІԊDԢ'M -y9u`R6{ԃh4!?w"Ű_\-j5d NKMU nXo+ZO g:8B` }M8=~TU)~>Մ @2 bSe7C_-sVns 4!@( oa}j"`;݇@G+y-Z_a8é :Vm]Bq]84;DXcT;rf$6)ƞbFQ87:4}dd܄c C; }.$~>ĢQ6\,J>eԩ:,_r7͜nﲤp״d6dnBqژr6<3&]C rRAd^ IA0  $:{y(81 OU f;tZn:cwum3tր$ Op4іyO6qM0Qm1Ũz%gtI+鸭`).i_m>ȽmZ} ~n˶՗r9l/p5Pvo-#zّ#)8 x3[`+6l`x ]Yy[2H#Xφ9Qc<+Ϊկ )Zz9e= ӬODzًCTNVMfc~#fom)WQ,KQPKg,᪻˲i{uDVЫQ {jXuVz},PʶVHfY$"؊߼`; ZܳBn4v/R%I:' eV!wנ7b&^B"3{b7ӌ]:P^JO#N XK hktcz2v(Z(<ҵ2 ia,kҝrom췸\)_i7M?u*TwF$%S7V |MhC[HS/En?{+:uuٺ.QJ8rheuo@g%1E2v0.bB࣢#$d۵k!q%ONƇ4GWMٍB0款"tg?OD9,<0>vE̝n{fp:},Ct)nZG ]'cPY<\83:LQu1)sZ=Phǎv]nM C?q8۾37abv`lI&'tmuq?ه:es)$T/eIyB̄Ϣ|pGoZ^veSⷄϧjͺdi2b*^N:W[k}tQeuO?i0o$ѮϽ-vtM\̄Dᆪgh'?t^ +v-X&m [sA=G ԜL)=q#+l#b L9j&N^֜ 2s6u–N!`lS {Xx&$uu0= f?n,.XKȺR[ݒ5GveoZ41Jԝ]Ut2vjMm%EkXFw/Vjn9~çi=ܕ۲N MPԯ^a]+M\!w@q`;~2D@UTˎuqhԎM\eYCиE;;2+jf;ol[yU-Rk1vř iq7P:.߹޹ ٔ{H3`AF]*gj2YzO{A{エOgZt}Z6O4(dLhempߦu,M/+SG9SP(sb*^_Mb+ʐЫȀ1W+zqu0S\iHSv)j 0UQoVg.Vg7Q`>ݱLXn|ӽӟ£Dk?DM:ۜB˭y̯h sVP׵76{{"#\ݵUlj} ִ8$T@iVIAD>^:~`RWY:s3G90ya7zgYiM:@m{~f?<׍0;dtEc mC"/! @1\ӉnKu-x UNBV^W+L7۽*+p!r4{X.z*c_Wj~|eVW0XQ_>Wǒ?ű9gǬ~ֿ|xNUٶbҳ55jF.e}vi}O1:{Ci`aEv$أkZJ2N-5N>jyk$Ң:)f5 FqN:soB2ȹGBӃ-뤵>p::h[EkݻoA;}sftPtnm+::ucd6MўXΗ/zZUM((c2SܑV;q t`䂩MAfffDei@!D%W:#St҉Ynel]i雧we;fhخeo={tqta4: >i>0/jL<3Lk(:ÐsC͛7{qYQjA=Njy -)z' ohף@㝹_dTc%O֎:B8a[:MU]~r5A5DcFUt[l-tMM3W`\[(T8dˌCUZGԅZcqeеcaA2NkL-D<^~h=Hڸ:P ySOt|Nx\c8' zhyZiQ:Si1`l׶L:.c!~i=^C<%~| 8Y֭`[#3Cqgpsү#-4WܚML.ˆ[--0r!6 Q[E^3vl;Jh>1xof7Y]y68ݣtc76KcWp b}M]Z{/Lv!mA!ZA9ȭ`Ch fPϘ tF 14|wma,@UŊUD@BbU 5Q7Όα}ygVB*bAɲ<3󱟵-js_NfTrVHVp̻̅k2hM´PXV@Md( ՚`N"TcPPX pGb^&{Yh߹q%kG y Z9s.~'g>ygO>>{z/xpv[b⼦uGXFA@:D#lHܛa6?߾sh}+t-Nkw B ɺZ!5Gwu>zqAZq}cZf|d0bY[zUdgmlWw6N(fWZe(ՠU枏E^9u{g,O5_d =UY" մܢeQ _Bs\o˼-^3qPdq/pr5V/]s\D}اL6ו妳V=Ioh]7 Ѻ1ps麃gR1캅jؓ]1Q#+R!K-Q[ȧSƆ޹Ώ{iXAW̦GbSG'7Onܿ_}x~>xp烇?z?~?ͳG7?|/>}qp>{<{pv<[bKYQW~X+6w1ZN{tQ\urҵ͔NiGm:mRɴ^u& 6m7P]KD [{kJE[aDe68A Ed^^DhtM`ǫ8M=(/vgpO ([IIFM:~'Ͳ}0]Cn¸M]>߼$WV*8 w_XZ!"SrRw2*Ѻ5,T Oe{ U H6lkkY,qટfkޙ$iRW{fK:e`O_'qWca/@5tVMgbY\h!M9V'm)9NMoZGhcr2_+Ao V^n5bvutT!5-GtAqJᢢȊYɄ]y2_gyvhwhMTwKkloyː?5P`ŠjM{C4H;rVq e:>M+2*.͊Q.S덉zT QEPnXz3)ȢlaPEqL.w;Mb80LZy6 kZKG$(̖6W]g?ru(cKHyGqqC>; yc!;eCbaݝcvػ3]U\=:C /|5~R~?=<*McgFq#HÇlH$x 6r}΃ȡ^QzJxHo1Nv-g[εA&250*xfM9gܷ9ޟ\Ѣ!2k3~vV E~|:3#0)!5! r Dʕ-m)p(Wȟ}<;L q^H. lg{<#ÛiaT W[r[{i%oi6sĻjE(θ p`[hb #ۖlҲm8ݛD7l):!UF^a DȭԢJB+.,RQ ygMqasPFfa DӊLl9t1d<݊]fz'zGnlwjYYR?W-/]]zoxtvyŵ͏ig;w_j=89$W< 39@n< ؐ{K ѭ!mIhR ioyWq#nlܒWУP)Z R˜0XbD FkêB&` M0 ”nAךL˗8Iލ(0($RI퉢cOk.Fi!ؒ)I"_ ZnS|] ]]NNN :]W# ׯk:1" Y^]cKQRp ] B)f*9ʃ{gLMF"jq2{xhj¶£xM7Xbip`_rE bMٹ۩}EƜI]^54l@Wʌ'4Ms#qok<6qDTH  RI?f6Math]h]#vJ:U(,&cf5z*6PmT0G0rX&M\s\XFq*,}XG ۵7jW}tף''Ks kkW?qiAcrqeasڅOxxz}BsJqyۍ 7K~{k׶||pӠWW-5.k[7jWj7?yqkva;YyE f08]/ \ Ak2|C2bzŽr8p5 R}N9E׼A ,(Byr(U*e"]!dI߇V4lS|.vFV^3IjV`DP6w"HGaa4F8V) WX]@5l!jhiiԢevrᭌ+BgTX+~zvr,tzuAWΠcwX^n-6D^\}YBa5ªAf&ְ )] )Ih`²"w<"*R@\$(6I#UjQ9EH۔hqR{_k{/s?gn{ Q-9"(EК`fYz<'A9pZYjaр̬Fq'2rz 0_ijH- >EWjRʗw)ֱa<P,<ۥrMtcL zLN ^'ql)La<_mex<3`.AkiMY;fX7 ??pw}+J]M!O躥©_SOa/8qԩC>|=O33_yivرSO>yȑ~gU p Р=ЉB c|#ĶqFD^B)*WLEq4"tE XUK[Ǎ*J4K~W6,O]pdc9 ہOm\ vdh_H 3#' r9Ilt햪Tvo}N |2"sքC7f3N赔.݂mfN Zе%,QC 4@&T%\ YP$PZʕbĪо#O틖|0MmOA"<'u/9NͶֽw.Uf~37}zsn47Wko14;wZ:ϴw6olVkoVOժS߮-pqί.ԭkkWo߽\{^Lh=uvj ;\\z{ޅʭs 3 !,6,cD2i-Ih!ܱК(iTtiNRB*cNXj)DDPnbwCEu-W T{\h$WǼaq܎WiFKd;6f}5KX;`Bjz ޢY7e-l~Yfl56d 3mh=9KZAQ-`[  G.[X vL)"+9<>"Y\\j8IJ mVI֪qQjŋH~}z*5>#2 MGBQsTR'RXb@ 7FEBy8I ^GNB5N ØY|jkZ:JS5+ 0pB^r7< xHV̆C5OP~R&NdE՘gV%Y/XG"ۄDЭ߭r͵ũ ^XʻgWUZ{eiʪW//W9tזZwmmzo|F4N# %Ւ꩒x9BTXf +QjCLd W70SH\x*;dƄN`Pé;-Z~`._mz~f;^駏?ww>GR7;-V tBHE1kdtø8J:SM>ؘb;j;50y) NwۃN'L:![V{حuB] (AuK ~f ['4ɟVNV:ٮGcvƥ:"h)gdxH\L'v<6+'GmM&U8ɘqt_B`i8%X x>$w0hMZ܂g^xɓA vOr4q룓O_0Q񙂄555PQY$w@*R@W0+R(4#d*ļ[:۬/uN],deW7vZEvkF^oɮyFZ];^KRM"ؒ2N?'C^:OUƯ{ `|+2KKLOZXh MZ?e闞{aiG(_ 5 ?puWGNlǃABSU6A8Jevc4Mp??̑Qp< q&0Ƥ 2A4!ȹ$OKfINOGe. fьD2|rC;ߟU_O }?:=sL'IYVI1f=gG-'"y:9 =,p(="كPݎF>Lb4qE4ʽie_B/ߪ/i'uw GoZP+t ]/>6}߇YHz?Ç?>:#wu/..,ܡg?rklہK@̋IxRij]WT5&\aJi5KT7!I%zAf;kOthF뗭vWuҨxuC)3?fZOj +qOZҵCۅTSFs?3OxS `q- W9!jˋM7l|A^ec(^@nJPˑv5&5!whJVݰ ;@5tͭ Zڶ 1A|6} G&'QFvnpd$B?:~H E#QI 2&#1Hi2[ҩ 'Wyj+PdQRY:B ey]1 h'9JwV>q Q^5:k\N8.se1li^UI0Cw6qV˴'XuEۋ*BvYNI.XR!@!{=|OBO@egm{Ajd<ߓ'(g/T.Aic9AlTv6a-㑽sV+Eݲ`22)aڛ'Ä)_N+&-'^ro<|%W~ӟa>yb]-RwVMmLc0EU[Y{r6nD⣕w !hdťlA|==:љߞ>Mi?c33XlFI񪏍ڗιJlyDih)V_s3BV9n|T>RԮT3Pv~])f䷖ ۏͧrZ5j95w-kĬ]ÈL/YEEG&S?cehׯvu*W Z`j,cI N~<.hPw!ENuG$0!`sL l9L;V58]̗8' N ?3s)~ao_V;3Oo<]FL)bzCY͟WjemE?4*7bUDWT_JsbqΪGFh_M\+,zQ͕U*5qKPˈ䂑3@性 {7.2~ #oA<is! ~)6\M0A|G=-|krt׫nA5;uۭV`;?6Zի7 B67|'.y#춐aB"n(iseJn+6[tmu%D;tum;;2G:q A{Hހ$1G\ ND؎F3v'niL]s;NLHG<xz\G NCHԨjK(UJi^RFmhh`@ LQc|`wc|Y_2;3;3z]m7駣3gsZ05x< ekTkTرkhm=56Lg=dFKj ݪummм!Itw5ᶥM:;.t 7_V+N KWDu+֌v?Coͦ7Wno`ġuhoa"AJʪ>8px͙c N-NZj],c”–kNf~JrVZ24X43q%90BL& x`*l*+<*P~(i 3 q (" tDZz#9t҈o. fބmJvOڡF]E1'K&u=L5 21gP`b:u7zgHCLWuM7,fdYuE25p p a蓀mVk_|gS aBxqTGyhaPtP*aȫQ$ u.*4JTFJ*5rT-:5L#:/trYB u4Jmg+5xQ׫ tu]gU'm]oժz.#J#@KM~f }msAXpWoŭC9vq8=n^TFC8_o<ڬm6 dz\ z囜(R:,\ݪW6FڨU@ړh?ut٩mF&.ig1F[\-A9ؔlH0|`]Q]a=HИʀmlңC1#9}7s=\tHQmI$pC~["?8Njs_laX^9t{D˂p1nO&/{RL"}:9ںxym,Lrm+c'7$mJtHN5=';\M+c**}RWT{d[/ّ¥Ÿn!nfQĩẍ́gX| MM?Ӡw JQ sdی=t] ZҪa)ȫQ¬\T 2$Z_F8ЈM'vWj M9JD~ijF~P QҩPREZXA4)*R\k%"V8Jk(C^sQ#63B,$:ͷTȟuJ!BFݢ&VllU3M[q!l#:T\k[WJ]wrlz'7e rf=.uΈ9s^2Ӯ;(#Vf%(ƈ0{ 37}zFv(B,]a^5ݺ3bs^!:/x_zB|҃@KKLkX啹*ǠbR7Б#8^;g@cwoW{;FGHgʥt Z#RlIg1SS Ǐ'?O?]w{~yN,~v47ַ}׿͋x;w~%/Դ|00gS屣LG!{^IYsS¸.Ykc)q0ZX2F>V{T5atdVh mb,~(gNKrK{WſVZҎ Qc]'mgo)7ω}!T)+$.+Vd,%YhZ@ʒ(Z`!`fٺ{RNUJSޯsT]FO4P .w#lj463rtN"|ovhȜ2Y63r/{18КzCW&B51[:l=hzg1NTPwУJ$YFŲBJB EkEҦp.#9EAkJKS>Y4R|z4;SRf4a-ՍZZpy;S<{mA\1'te{7Cd/ !<a@"#/ L5P"`"v}b&Q>i6Lu:xvŅߝZ/Zt{yaziR&lM[4ւaժXpi{kbo$ ձ51JZ4IBY45K3 m$~C)p kLKXaE.p.FH<^ٌG.&` 'ϞϏ Z;02״ʽ-:ALлE j /@ϓ|PC0i{S͈8m`6&IfPvP@{Tz{,dG%HרY}*gU4(fz^ZP-afދwH-÷*oß9lY?)p"i}->7K~˿PYhfO xIO%'Ao>^B6}ng-ON kakOt Ռb |k| If\"-A/S(#Єd KXF 7έtd QFvPIƥ8bGչZ铂2R]Vg+XkU}Rӧ 5x_\.( :(V.*3([[ze sU!Wi-K'o07u2rcq#ȘMЁF!6ǩfI] ZۂۂYeиɘRZÀP{}4H$R(B\ (0NH\-EP ZO)Ѻ l'-#H"(VInudR&s+J^e@#^gz]z+hD8-]7D|fNt•oe?@v; w!Cu؝d)ܴ'ꄹLl%py3#ƓzK6c9^3%bsᆫ̲aBѿ6Gk5)ֺ%:9޼߰۳ngå̋D2ϛ ^~%5ӹ9.y/hwpvI"'Dado?_W[&03ZxF^CDͯf8"Na$8 3(W^}5\Y-EMVt؍""N%q6LN?}h=95 b25 Kp`Ϟ;1Lǯr'WQW~ &W*WkVoO#8~KsNs{sǴއz'-F$ yp@#{Nw b~KG%㠣C`^0䗆tMIkHK"1d:&lP@k`tԧb 3c:'o}CT!GM n^Hhnޥ2D)H|e^@8s SE'ˎg61k_HsDž4YQDE/+܀gի4Qpz\+|r/_ʅjcSGl(e{r~$W p~8UjN ڕ@Vmř铢2)ӵƌ, tb uF] G`&`SG;&u!%ĊϷGX.6vO7G}f@1ڱ^&EfT2K6nY$˖ K6ltիW. M\(GECM9ǞQE J0P#(:CDRQoQINv#:Dq+iuV+I: J tiQmkȹc,m0ۄjT!@i ˘!nw@U9Du;kB\nJj0;kNkg5wɢ-339\;!E ZA *zQx9b湪j^ (~swEUA 4vinwEӗ..#:0Jo}Xxw&:8To洞%dŏ}Q-ӏ1_ZoW*t8 Z\^>r_{cxcIbx_{g<+OɅzsMn*5L[w5OoZlvcEBW%ᤰamB]^50ސ/ M GUXnEeNUXni^$ cue\T;K'ʧ4I8.UWQ>S+mv r,: t"0&"vC k.jڊA者I;ɷQ)ʿ,xp8mmW}Oϙ:25 kx3*hM( 95*>]"j9zB56XF#<  D#w(ly0 T FKkdT)qq꩕S6&<۶jòMYHEP sQ?GN-ACG?|?E׍fMv,c:m2X' a[ƪo!Uifz.[ME!nL[ߍ~+~t~w;Z麇9͗AkuHUq ]Vv}%HǑ 5烀gp'3c{d"9hA!>r/9CcD$BN>aէtވ*nn;}0'@쇜2:~}j_]x?O/ֱEc:D5S= jʚ[B<铟-Ϝ*gc C͡ ~9Zvibi@:7'o q $xkh]Nt͝ss~g,ʧzRٞܵB~楑03§i'xOؽ9罽BzZB[̤:1WgxV_NX)ꛊLgpNfxP~vv8g3қJ|2[0W -aRg}3y)+nptB0`i&>դ|#헮+>O@tpulñ'Z-sSᘠkٴ˒l]2-%PLŗQSҐ=]DmIZ1 1 rU°U@5pu t\-``ҮKJTo \WluZ{^6 "]?Gl׀֨5 tVǠVk0#5juݮ7:00)53 2mXot$y!w5ȫƠjCBllU?WҼ*Ϊ;xO5%fݐ33KZ)fT Xw*=ЂZe˭pˊ6~lp)urV!Y]0 W7RBiBk j}.-eT]yRGʚ.ǎfLcT'o`4:/@ZN,[oT |]Z)FQQo$qBpDQ kcǯ"WV><ÖiLy{7wG-0dDH l#!gfz`W~`!,0kԍ~{?<y_`bSG~ع9]l떽aޞ~"!"ɝHmv+'E徬N)%Q+:%12Ɯjm;oic_bYpջ2R46)^Jy2 t#gI?*˪Az)\aք UT¢=S =UB.)(6ȷ561d#t$|lFϡ?c`p<=Z;*drU}n~Ӻڨ]KGB6 M,.N Ir#HsAqAן녖l>g٧d2}n]Fy3aֆ(L<9z&< 2}~`ci4A%zVڙ2cEOF2DAX*7ҫEnMY1Pȯ(EƿꄦjK?RwG3SWlڴ!曲weaE5+O73 uH.G(%xZ =11&;N1NZ-ŤtuKaƩĕ_ZJ <0FZG؅t/y!$q+!^ TܒPѐ@ xq"[6um#i<7hk ϰ<],>OԿP]Hf?>H1Y"*n:v7@#9 8PmGxQ@gP" GP,ST$K<>qJIr6iv)9}|C?;:}ӓGcso>X:[9˿D3[~9Lɥc ˿Z\ƭ}uKX4QԵVs F3jq56*F X \oaEK*3qPZn3f4u;N[6!1нj5_M/0pc(9ot㐸HoC|E 7bitwmd?AWI9~9kn߲n6WߚPq He ^pŶ}?CZf#&f 8d䟃G0̦x3%S-ʂ.&4H!(*'FT$O#C2:^bľ fws;3yqz;7(aMff i'#[Лgstr٧NMbo^VPY}/қ/橞p)5Mf&ĕ3==]VfXH:9*RMxS}5ʊRaYO,)JQ-˂7CQ4R]vWݸ#[Hpu`w/)!q&;䷍SC/=5="A .PVk' K Y-Y,Yjq!37I6s6~2ڋQa=3o}~5 ٶXd!X(R 4S2^LI3헯6Zoöm",  І1q}\@s R;% Kh%d c~\kRVJF9e 7@DG,tڡvwh٭iOaU1`ݩI2Z}q†jh|yNf)dVViέ-ք*mM fPJaĥp)^֟Hp'6j='>%Ct8`Q3 Mw~BTs\ZݢB \`> X82K 78{NWPQY2-~e$qί,DzwsLE6C_е1U>Qƴ#jOYBS6z|'2*>\>^ՇEgE[/aE^E,S܄ekAQot)'jꐬ˚3z]Pg\H痵0,qIY7 CΥ|r\M)bl`|DaN ℔)oK|z>w.ou[U05F*s.qul==Gl:v:D1{{h6kwI>m"r[h]oUM !(KwL\ƣHħg1])HZ\] `ۨtw}[Of֮%cɫ۩ޔա4(ёmm]XZtχ lY.[93mMn!H`$:̧r@2M%ө7^X6&sB\e'lMVGdlTDZQLh ~n~2= =q/lUضk:K!]\zZO % V.F%IqY(waN]R2هP)FklF&uGkƶKT ;X>VW56M䀮uz$po}wJLܚ؜_ۚy޷ɍ'`(\/򪨒uă`հ4)"3HYeeѯvYdlkY)-]_|3ןBw9 Nez2+_*_P࿈L|GSKC=/^}1χxa>gszYs[A,J\mW˻Z^۫WYwhff1\sk7ɝ]$}i@m1qc,o՗] /wrZ>C/OotZ/f:ŪWXhyɔ-{8^ч{4i ӏ'ˡN7L;MVoyJI Mt4$`DFG=v ۮR*ururi)7YаI[5]rmBCjH)F6tI&^~hmҦӱBbGC6eDz}a¶`A/U}ѺTJef Z Z*%LnPsunP4+fҬVzVojs:utj )ȴvEDfhךwkwGVo\M }h ,]D 6;|PeY`,wR/OT]gm\W6!SMS8HIfqb׉c;NveǶjɶ,/wvY$ gw g)QC{0C3sS}uHrZv q}Ufmmkj#u{T {U8s\ˣfy@!*CfeZן Oؿ8!ܫL)Xa f8W'i] V`.D}G/%écM_ >rDñ kEYT}(*W>tPl~t^ 9(zz0¦ɩ8Li;W(uyf+xW_O Mƌa,o\y;i-A!I7tW)W-`%L4I29]`d7nyMQQ݂%}Se Z+gMbkk_=L2xr)GNy~^!y"1sRR3pgOJќ岋8;_ӸE)!t\]oM˹Nv~&}//(5ՕLW0U%˫XA疁XZ|`P:gt:v\nHmhc%Uqdu0'RNI=ŢP#TWmxa$vJnRvmg=F(Qz^jqK@D]'@2l:$- ېf8 `Ծ% t {puǠ~V"n NUT( pXjC#ҵi{64/ `lv=!w]W3 +ÍO'Xprȕ7{ݿrjaѳK 3 3Čxl kY'N. _,::@Y%gWScKe |xvM+Urz ?M}4|b"7ϒ4@Kwha8ō(˵QEBH*%7 ܣ9RwXZSMn *@kglBgd \ ֕.e N؋VZtXETQV] *٢F: F)@5H ADJEMu5v5ʨi4j;(MW¬ M[@u#cwxM-H%T&Grc;9 QL@̨&_~s%1IE# |§-#WG 1ͥbBj9G.cd/ bHE%\}D7$:\0'%1@.t*,'Xt J-9#S*KI;NQnz!ףKSdTV^$:ED=BƇH41kx a$[eՠkB&r2|قG,th+F_& '{~ U?O>jǁ쨅p8 u9=huؓ {-o>u=moA[ۛ[ۛ7Ka&\Ff]hJyi\8eXMQ$NYUT8Mu`l Ұ5ȟnشm BZ3>W!!6:. [vmRhI,#"MGࢌ+x7ڜG Lu ש3uW}Xy5MI#aKIQcgۡxkOC}OuHP,5w?"ŇTt0 5ׁ1$z L;mh/7cARxlyʇ]ȫ!_E/v= i%hHvx[x?raP=jha%Ёdx61x"6F{ŮI !aUJ`_|65)%uI & I+V4m$j@U`jd$oj:0U&kvihA{ha,is`WP[-.dl.gY9Z3:YSe̼e!b>W?|PB)^*yvi=_.7 E[lpuBFFf$lB#Qo[Vn}ʗG t6ND&;ҜHK֔~'5%/V P[VXLojnJN8*$Wr}HU|*!Cp1؂hE BFaڷ43zF3#Hܓrr%|'T9U^y~/k3$gu]Hٸ@eFfQ4? gϚf n}nTV^޻:74*:h wcZ06w^Du/wM_mڌ4Cڵ >=r[oݻ!jm7hkAl '+ڳgO<vd=(pݻwrA,Ms45y7#gcG?f6eSH~47~[%+u+M7߁͝s'G4ӔSnr&42l6&LgX~Mײ ^Q 2f#csr+LЩ'DXjy>*v`o겙4U,@eNV. y[V.r3ҚMA8A1Gs -!ctNg6*zoINz K,0-/.T;ԤJ*c]fx&t!| wQ<5o+HQ^5rl'މ:iH^.Q$&5H  !-8ڰZ~d%bܝ!68V^N֬4& Rd!nZ/%CZN@M٢)I>=z&qoVG=>3 Ŧ !kYDs i'6&t6}͙̔LL | M'}j\A ,g4>e2|vH?'@&YYcш6ԌVյ1X| |Glưy⊦X#29p]p.v\$TjKA ?MP0vUWEKTA@:p0 Ǝ9za]jej8ܩ9(v` 7"]LCA)ťᨀ&]̝C믿sij5I` i1MBb׆m:3Lki4 Atßw7sv>Q?DBi>ܺ$]Oq-t=N飫ɶO.$F,.ɣc&JY8Sox܍0VP-7Fa}z 7pYŊnDV2(t~e~)߰\Oo"*~fh[ZڡəCut~PO/saN_8OkI3%.2K_BFUmLyFvHYϞ2s}f^;yv &Q0k{ϑL3m,,ʲd-4ORȚ_V@Nq+\_7m̼8~a wخKoqc Ukye| Ɯq5 ޮT7WK4̶ڦ—0lƇH%Qmx^gn8׍O%[Ko<x8K96CFlȺ`|ROp` | 7MMm<G%Lq}׹YΞ'nNs5ZK>1ݗB 肋Iu?y6ո*rtSVjw=)?RbsJDҩS䥴CWYiәJJ 6.V.H͔EW(zb))c}Ϗ5691>VasTaun願^Fx$pDn(/g;yU5m 5We#׍ܰC${#L0cG@PB 4@XQ BBN \(V(7JjP],JX-˕FbU.rQ _nm*R%,Uɥb luϕ*F5@n͍T !I'3]NVvS_uui" 1rpҢzhka7u⥊eEeWErek-QdQl2r}߇;-ʱMoɥt><<>}4qd0.YKAraBBaͮD-+F%VRy2&ꋆ4)fm)-hřS9 ﱅ)Yt3 zo2ٚ8~К9¸"NƜ^Lk]FVdAO8UXKeTaKń#ϛ7 DrDټA{]ɃE5к z![A ݽ?U5nǁɕ7H,8y@r[{xc{757hԞ={~[㓞DBwP׹?xCwo5Kf>K>vD@`x34~}kr?#hoRaO Jym W25tq^Zx`,ux>Iݬ],˃,y pVo1TC*{gҹ/\>_$b&c3+H"d 3Ŭ-fL>3+*p*ٯt[k!&\,E]8Kj-<ᥨίhD0v1~.s-ubFѐNXпx: 絴]SA7Ab d.aElX )r8$zln'󡆥ܹc`K!43ˋ!شZ2TMw+|-TbQr˖[RΨn,abf .x)$f9ŝbzдUY nD݌E.ҕT'aM-3E\ά}hc+ӛkBSay]jhwr@'ºGO7r_fS#qTl<)|,Sr7"+ _Ί(VHӖeFI!܉ۢC_Xj,6FMR*EL\؊\!cمΗ6N}5FF~y N~;ƁaË/NaS}@@qXA~QyޮoAрj^4,5U0^d(H.]”PEiV.#4*'xeǑY dIRq Ҽg.RW&; N]N>JVؒ'i ꠈ q.3fg!Iژ2ݒ|a!b|KI*ry.?,֗V!CY /CX[>(Zruҩp"5k6(kkmB|$@7M[`ZŦ_|g_ݫ<\ :Sw}CC'^hٺuӦM'ZZA}2lڸ~Dj2 b3Wv4fC?xWmu.7}oo5N_愞lN#_BIE9:?𶚟h|.`@ =VW`pۉ 91$>=$tu>(ƒmY5>@⩷^r9={ \HFO%SQ!(MKoShjӭJ%SˆUqmb SG9%9x/I'RwԮ@|gQe*'D M 2Z~ qӃ r2gC,1IGo_ gF,x;N3PRV2 B[ YrZcV*٘&_)f't>{Py@"F1 ĢMw4,m ؄>]vYq %(X03d7094r+K0@ɕB׋:t gFjJ(/+;"u 媜SU%\,/'f|$$ ݬE33Kス -ELpb0u8۷#ws~2ܥXD8GfBSD%02y$bҝI ̇Υ}Ti\m"裘t$i| 1xЛ=OF&w/[UFh'?x/?-<@,gw456Q_|s4zaQC~TA߳޳?}nKhbDžl,m˲I+YCҞ;3{Z ^{@ NO]Ahj^W{Au`v tݮ5=T7ۍZu6;FéƗxxѩ5J)F)QdGWs=.v ?i1|4q\3#S6Z@sz9nX ׏GE Y Yո 6礩8y6洀&9kT sO(#'`c|'<EDz$e^򾟀~,Gߟz?/>'D¤[`\{W^}5Ax1W-å !?!Fgޮ]_xfv}>g_71>0](wzg_z^ʗwﷷYquڮ>[Hutl.A""Ww鞻LWfbm☻laJ2E$v 1g ƐiCbOF1SC[ѽD͘aY:)JM 0ZRa0޲j"g CŠ?D]qjxM1Zʐ?ӿH'ܻ`^J>fq&eP pͶjll@Ƒ5 eEg2PIdB V![`oc6hh(%GWp u}?֭lX@JdI|R^iL5a㉅ cFLf'daF9E%P4RݶkSslHdu1+PrՍjVUBMREvCwj[W\ԪVí+vr٦׸-zfAIip"&!,R>Ym9֛z ݮ;nrɭI zCtzKJ\inԻfZ?~?e[tkI M 3`*wz[L# :Oh\'C@rh7Q&?${y~VeѼ~߂NgwhvLf37C?Fաd`\ytKdNoƥ9Τ8 ą/>G[ 2RZ}HjX`cum@rB]q #Ou麏_~dm!m`iM)arO Z#y`3<` Īwxۚ1uo[&.Ӷ!kQ[Yua:#jGҖ@Mg "DddPtl(AJd/E1ӓJ bqJSC0Y339J^o"9Ngf–$2$G$7\G6kP8D`d=z$%q? DƖn?!!ޚ{^sGgO/.G./,=Y\x3,N'Dw_㍁$zqNIs0@&'&݂éJ1MP՚ / U<@ j$ 6vOe xYCvTC7@UEjXQ4{9Ј`yf=f%@un;fi6:06ҍ.ЩrT=`v][dvE,Nuw߂Z ?dlycȼt lHW'?.2ୂQ'>/،q-+s~nRa:Tc>Ȟ6SHQ#,8$ZBZe-0*M(9mװGJF1!™GY\\0l |80'{1VA"n&m.D.hGr>V!rwV>%]-~Rx+ -Ve1Ί]TI*[-͟3):AGi ٣}QVlrMAd }Fs #S{D`ll*v IAF6!.Y{7W,L7NN"56W#2$ފ1o(!^R 8p=)B ?-TJMh,0˛+weuhW:n 'u|j_.2Sk?>ng'jR+AtOfXۜ5^>fks'<&jTL +%G,y3cPv]r-TrSV4eK.{zŵ%djX3"MG\5Ų596xbN 'î1[/XHݩqx_˳򌬯YeFIK]5rEH$ O=XT#}y؇<=2CqY4oa^(?Edb\eJB5y ݃t0$Qx4!5h!^nN"F\@鮭C(E y;ͨ\w83tmx8Cݪ]/>98ǟ)֎Kpg.]n_q`U΁΂5I3J!˲-06ԓV#!,K[@B-u!Z!nڱ_tE2zƍIN´fw4OtAK]&[Ye[f! We<7,!Gt02(y>S2.XܱYoIe_q[b}+hF&d4ڈJ&rQQWJ\h?jUǕ뫮? ͻm gʜ?E>XRGT,c L8Uyʜ|t]=+ JѲ:g-اxnIsկDtՍCqZ!Gk^G >nw d=H48w"&z;[;V'g6$_?hGYbAсg\ NDDm>(" Z%Om^QNrZC EdK㞴!5 \D(Byx.HA? :8<5DQnoh}$+5Ja\>W}ZQ8i3f.>-K)fJ5J 2^E:UOV34"7'Q'8H1j׾MV!g7c( `A7)Q !cn@4)/-QIijr1Q*qMQ@N(g~}r`æ$h)\ y 'ȲB0HV",vX3p< Նw?C] B4 ȧIH4D( 4IN`LI҉,nwIN:i Y7,mQ<_ c3v 7WsFXvgT3aHէŝ{ܸިcwS aZTKcqf=@^[ bܥK{ͦ=M*SRao57-сe0T;~IG%{Ϯ44#6>CZYfd`E? ^{ xo+   n6܇Ӆ/ZZ0? =u3;/ Ґ1jp%\JHPYYe/\4W7kU陮"Qƌ|mg??`1HS͸#Zr Qz++4=@z9sH0al?&DY(?PEoof 7olk\i\*Au`H{Z.ܒ7ĵ~]~S"'Y9o]oZ QҴ'9Fy3\c4h;CF t tp19aMqNau?0Ay&"Ze2Iz a1р̺D k0_Uƽ8/҂Z_'o5M_Ň:yk4ƹEy)fc\p|4fmϻ-b1Rq&FgʼnE`V5*e ofxLZmU_ځo˚\)9 KJVl~Goɋ@o5v vY9؛DƄ -s)'\pp4BH0#TcФV3kHod(ȥo$ioZXZa98-?\N FNPg㣶GGGscl7<eFv)zF!#.Ax۹IA?<Zb uPA@p҆abM%v&3 JI窛=gϬo1X̕<ƴ.mί;ʉ'W7˅댽Ǟ~ij(^i&.M-? NB$`ѦH彠ޒ$.I^z#~g{8urmmRgTbaв]íaxB]  ;zBMtӘ6|;^i.NII&Qŧn 3.I Ϟ8$=B^[Mz#~Ni' :Y P;f;i''!NQGI!t~~q-gTfB^ј<[Yiy[LfoZ5G+O ڧq46_Εd.&`,_jh#:)UBAv}:9 }؇9@Z\}5}六D@]t Lhf ]Hma#p8lݥl_~/ #onG}(B:xKėRm1ċ:^n+#4n_>uVkuvJ :?/9!>X3(%oUrEx:Vya"XX}h֨kCW5t,ӶsWk(jK#m/!yHO#7BLAC"hEaJ$7yWz *RR5i (%E@lMlc Ok43;s5UU}R{ӃRn:ՆiaV;GPn%mI0{cnYzSXϬXEvih̋KM1'ineƘ5FKX0Y~@m2Lo?X۪4:ˎFbFS4D}N4wFt'3~-+O`ҭJ:(3Zu&ŵQ&߉8u^ͻRzެͲN/YN ;0ox)xoGpN8qevBiZQu:=:ZEA- qPdE~l,rY:Uq$ ~'.O!=^Q9VT+t?{?youRR ڰ_eaocZ^.>hQ8ǐzbeHZɑ0M[LUpU.ҵ.<4r|vL?ԔAe=EM+ԡ(K::{[R$2ga![PAin𝦪z%^n2m$VyRʚ#{Mk/٪*p60F?*i #|R?r엸 )S*~͖uZN}FD~NĿQ\u}W{@y؃uدZ*6Nm-MWiD:SkZ;{?N8M5[4֠5V^!`0ToDhXذ %Aiac۸]{Eyvù,q%GH6&Y *E^Z69k(ʊ?aY6AR4=Ex'~O~Y)[c^MRغX^M<*r{^T^ M$YG.ۏYfKo?c%78Nѳ7kѠ_W(PY%m)ŖT7 ꖌ41(m?063Ϙvc%zi[|@7*T /7kk!eΨ聁qGkCV2]MPfV%~c^mb^4>', /ghtׁ='@$pB6!| C'0h-~BtLs40bhOkкBtʚhZؖqޠ*ϰS6ץ/V~7_8Z?(Vˎrv' k;vN{)>z ]HЃB2k{~Fpa"In센Ӂh2:bzZdm%Ff~J16MC*o(Šg >ڢ/6=󂻦%fvE?iOs횕6;Y;Nމ(j^vv׮\> t@?I,$C9y+MniDR?N V:IŽN ^ƽV G4EIOz-H"dڣ<ډE71R=pA; [q-cWOCSΕKURxv#Yʙ"UU{.N.ivZ9sNRߒ#[Q7I/Hy3OٛGhȠ& ǀQv =,65Gֶׁc-HePRXP$a'2653X԰9 f&b˳\Xq @C Z[fYV$7CKV+/.VEVV?[\\?}83AhuY Pdw4<3Eaz*YDTYGƌ'~^Fp )aLA~,2t% wlta&(pmZe[YɡJҩ]~f[{ nT c~// *lWSO_>uSI5tQr@ljoRլ^u\ӵ|ho_5a{-rzA|K`v@@aN{unmrtdck=-[ꚭ n)wܵ$|5[k$bn?0KΫ3$NQ@:"ҶcLdZ`r*D 4ey=6aJ_z*|S,cRQV)o_K>_wS(NHZ2P %&;1]Gcn BFsmTp̜-$^dq` dm]#)|@XC-HIs삕%pkH+6Ƙy_ފY\N.o OGOG 2- l$;/?'}itg!]*~ZN +2_pr0Ry<09%j:GeE ,'+a(.@ &~&n=y;4qk^kЇD4B<2\X!H57;#H^+CƂdNQG7 =FmEKulųXRExBU})+L1:7ò1A9msy~/n/ﱿ8pqc^E>N7n>TZUtqf 8QJ.'jkٟ-9+;슘)3}V,ZǸ-I̚BS6\KM֖45 8㊜Vv>= : I#B[R3D:2BsAU c* qYMVAنHTC,j‚)i%7iCK(@?y,(zKh 0']hHQ NZZoJ;Ch:vrn;Uu\rѯ7v!;n|~LJW]b~@` 4*mp2Z@uopփy n.- T)[}us۶{gz7 juVˁxwnl'i?ZE=3ҥ"{!qEcTp1Nc7r4sʜ 4bJ, +&u~v۸0E/EEڦM)j@NčԵv)Ֆ%RlIEkER)q 3H<@/WыGĐs|2/?xN_\"KCx:qA԰A6S8lͲa€A3 %B6ѐMo7]A{#r2.s9aLm@BT{N(hfAA.^#h7`]!M4| &WYsmQS5xk1U45N3𬦂fa53"9զJ|/)*dں6rbgV+-J{lVu/6K^P٬mT{.wy}!7vmeNl-H[%"7L^/혵[ Mb|"$*M ̤HϨ+=7%ŴQ }u :vuK.0){zTjPWrmDhy;4qyվ@|a>LX2-TTu^&?GecE]\Ci7?Oc'rpntM8]7ܦ Y9ºHW3kI[1qsrqL +Cy|z95L=HFѱtr6-?ӷrY_ΖKI?_Q%vTqͰ`ᣭ IZc伜},HgtqfH Mev;ݷs}ouIUtdA١&>unO8Ri?1E3Fc:m_ZcjL13DbOOxmǏ1d@$?˧IiEc #0F~7܈Gw?vj-l; ׁ̆Qe*10ӎC@Iw<_!hi^9;팔YZ-ibR7%EMXhJD:Dk"1;2s4&*ϯbZmCV+baMc_K^)v BǕSTM9:ɬLVW&bAƥ[gsŅ/y8_ ԎH!VmG_}L^2e)ƦG eʆ 91Jդc-v}&6HzbM-rLY8wg{>JX ` yhx^S:o1W (876tteoWWn7xx-t,Rt}GvƑ};@.OASၽ KBN\Y 1Å?[6\D~Ĺ%Kkh2%^e_HLx3O[(hpvU& [Z~rb1='JjZth,+]58oA+} (WLin+ 0Cj Zĉ;xt,֥p>u=~cv}Nĕl\t>fdgU%]:n6b(";3Z:PFRfGq;cU?b4`2`-;no 7h@{^tzjsS'OB wz]r8[7mگiAlzGn-zWl4+Oy-F6!]={=k{`@CjzӅZ*L'/^{{^oͶ`8ݡ˘u/{=' j3b/#4\hWo ?L?D_^'$j4l[Aca . kQɶ $Pڡ7v9r)a 0':}! ,CE -!Hzd'2ʎV7? nQ{Dʧq^-9*[Xm",¥펫kI:ͺȴNr6: 5e[%t J1QfG+;Ћӟ63K_EjUjVj9eIB9HBHp&1m06g< $Q_E?oJ?0|ϗ#xy+rqY/QLIס("U Ynz6 %v_%Sωj(LWao3v!*=D@?/ct`QrÆs/~bEz H!Nl °P 8  6 XEVa `FPV4]uAUy ʩǏVp+-`(M4u(<m%ٮ﹞{ΎzΞ|3OIEibO=H`}&fCP͑D;IPPQOӂ9'krf c#6)iɤu1i bqE){3L U?z֫|uC뵬S+5˚{ m% #Qf9$7#["tTGWsv]RR M/'w(I!ʺdH9?<Ov됙sslWSԥ[ I)>6HFԬL^L/6 qض>8 ;쀢Rc+6W̧OvA%+nU[JNBWΐrKe[°X "C^g.nl gw9˙Kg>|)tOC'tTV4G-YDֆ̤p{qv1x-\-s6lSw/3}ffcbk̋JEe]íқO'T\:TîUU@+6qfE$^`RRnޒhEJcOΤ[f,Oj6O~?m:&_,%-+nʷ:JeC6S<6ϑR}]\RTeBISr{yQY~A m,?I%Ol? r.% P& `O_eTEp#.sk$j)O];kGS2 a>5Db txjO *#Գ\ n纋"4ņLo_4B3T!!]1f]b[UH$uZr + [aauH  9IA}Vߐdʶ5ojb6W v*+JZj^^cBB$dhXtF+L^]D.%DزU+i]etO `K l;:Zk`i0Ƣ j j/.aB~; [i6c~&FAEv렛`̶A jF3a0 *`g \ +H,cuXjNְqtI%Ay2dߕkKD]?,;3gW}ʣնt&${/ta&K-eVTK2`=- ^@kߴ}T*&+ZVi}S"0nl.5n uilK21T}s\kU%J]z+wKW͞x>/{Fy{doC酔G)3F^eQxY5gg ^!n)~I3| bJM9&~r k` ݢETcQ'iNViO)"K ՜nO+$_a2iwsD?,TRyF(K 9%dD@ݽ}!x~rmF]X?GGp¢0~q&$gQopYiEN P1.M):>EH㤴}O?ԏ>ڗ~kT׈@B=j`C-V4w>qq`fi_00)̔ҖitIk:v'v;NW|(-[dյ[{ߗv%PG\3;;h} *AE0NZo7ط$]cC,vw-X{.6UE i vOV(r$57k\l/rS*#+QUQ[*d‡)][cM[q5 NJlLWY).c25R^@v2?z dz'9qB5sY/.,G'%>+[uR׀ h Y8 聠; 6uR'YF eN%ױk({e ` 4[{ν{ 2eV=GAit3{ۮ;'(avٶj9?P [@Ԧbn,HQyweêe63E}Yݚ ݍk֖M?bdRGLt!#V"U@i{N~_rI- 漠<iflۇ;a=(6ͅelCi\lY$/F{ wIm,^HšIwVSo$~D=_>|}dutz6;n5߼:q/" ϷG^_G1_kTOeiGl䓽sH_ygm}f3Z]˴82{2q]n\?]c,=]xb VZJ#|rKE42L w.껡?ȼD}cdfC?IɜYMԂ% Յq>ND 19eoU~B3WPՔnK\GR\O%n{Fjr*(!J<866Pvbt}! BY5l\ZXaW-iX+_FcMJmZXFYϮi20iE<%hR. `vf&WՈJ-P[k; m@k(Κ`yUs:3yz.=BvsSr oZֽbZA#p  p E4@/p/Ze"OKoE~Z"W=K&K ~#_d4mf0 :I-d@ @L)b(0'6K%)>U ݮ$zSpIM IFx!-Ky,(UcYZ^v/.DG 圊\P4u4,|L]E!&Y[3\i繉?lèS3Us*-,XUwru=|$q ,~_^z{`CdbDU|Yo)):up@ؖ%ؑhs$k_)(Y8r3l/?s( fJh~< co}Bj2Qlo0Ś5uIhJ3Y6;[]wzncZ?Im][*'˛?4يwlwqt }~|\o> t@'n!Jb\E Heĝq0/l體қ;!#?LXU5$j] h@/]mh:b(Jޯ-\6R4"7 U4GF"E|H~Oa^sEPʷd/Sdz֖0yw4L>>ׂi `d0c%MSl`y}ܙ" + ˱q PRZe־t,_^eN6x$;זH&JJrI,ОBtك%Ɖ&G*TՖe $AuӂM~9LNFd9 4י/jgk/Cʛjy b<=uԡ8Yՠէ c۴B_@!_NCkifH5j^UyE"'i㏶j8OFp a؆&U Hk4Ķ.9]PN5‘pd-^ B7w{x#ޕBbO+z"+Quv{c)d> /:<>OvvWz=ffýcW+t߹dqu w[]c .wXhmh%}7\iqI&xQ_' =g%gXk>͛W+ΜXKβ%#j>U v~P[?8ipuHG>8_׍#u(8''oNN@OOVMF袔 }'[D`ZۭDmDg;}A?`ʣ/_\Yn,|uOÞ)jLW+5&mJv r@ ]ێbA9pQX<+I&WҶP 9f_0JI`s<+=5 H`IJOoa*nQi%)(mjU@JTw=b^1--<ϴ1dW{>>xw:[~z-j60f{_gvomD~g!N/ZLL?8~$ v\pbl{,h>Qk^Y[ksq#L<clb} LaYkǭME8P麞kXj)eS,:ROɉkY=H5ݯ?5ᙔ\*9(@) #Ba_Mva&ldT*%ͥxqkkjztO9?X pa$ȹBߝlvMHOE13Aؒs3e.YYEZ@ؖ_LHٍoP¦Sɤ+ܶJ rӴeV۝+FM1N rmi/TiLi0:+KTC%b,a*7LKTí spA~/jgmTMj on( { zC{_i44,HkX<hmk*)vvR=YF3|w6q+U?U vpNVm@BEEP`RKH!wH$N۱xoIl9ơ+==yf<>zޘty#o;%f14BJWqj 30dpZJ+. $NEMh_P7j 9{P2 ^ {b/yFike ?´k  $ulwD!ͼ@~uDma^ꊆz&ha(Nݔ %:ZV(A5N[dz;~Mo%2 XEdՅЧታsX,?R.W/zŊ}L£fl}zcgc}nsw#dckkaַ𙍝f"tb Q߭wX"F _~u;ijqt$7'zM6' F tB#h'2J:Ot;+K+l6+gޛ6]D6'+C؈ؽ0CzPM2F:.WEo,񍡍Ngt7sNqEQxV%^,]ˣ룱ڴ4:4Wq'Е}L< &MW'.QRyl25Ųn=G 2`͉34I @t]tpI&еEdV?3QD;s {rBQ5EM| e5q4{ג:()Pkzb|rpgEhayAqO, VY+ ?-:f+K.!wZ2?Zo66JI v2% ^0DH;iH kP[,4qJǾ+r>DU#\-auR-.ǰo W^)E,}M֓B,%!AaF,[#_?:wYl: [`'W`Ol>zzy6x@>;VbpJIg7DC$8 1B_,=Xf8Lǻy)j9! >vP.^K ݌tb `szq'u&'⁷B !s:bIQ{Kg<a5 ,2 !Oj,|lR7F!9E|l :(1FCWw0MELŐPuQo  Hdl|, QS<8X|bNyy(uԽgz0'Qv 4V6B"!g׈LY12G]uy{+x%:m8>h}(m- iî$;q&mYmՎ+[Ôdݗ%Y$eH.u:o cgiK ᱳ3 E:)an!:,ʀ P )/T4 q^aAMA+q|yZl TF\"^8X `p($-S\Q-S+T[Ɠ u2{j_ȀEY)' m ~[ W-[шDib̭Q<BY…$Wm]6+L gMնM۶XZEQ-iֵ jvtT{GxNp3cȧxy2%f?tɗH\ X[8w-LfHTep5CMb R/-[& /MOٮd9i#qv\@ӑ Ɍ>*q)vrFsĎq{]W, k¾.3>u$EwyJ9^kj{> O\Nc޻Ti9w̟%7؏"qQz^~x_Ql>HN5fVs}[EG+a+fexwaA4A.>ͦ`ZTLVHཱྀ-κG??טu>y띟n==#! -t&<9id-K,IpP@ZlIq>K4?bb)L#T&sŹKKG;2ҭS3`9}=̵^ɒ!ĹP}[7c#7PXIzĹj!鸜Zd 89Ħi7ZW(/H 9, ɐj@2.Cӊb! 8 KP֗Faz)=,W?)DKzՄob'bfK.=ɴ&=q6+@Q@P 9(E/avZMu9xKNHdٖ,VZI"%ه6kܢ -О}x 9 3CҾVYG ٳy,w2#V/r!vk$v6M楢N ]A@K7 Xڀy%jkjvs·wzg.mа54`m$BwC(?&IW L\@#G n֚aASp8I'h"*9hX}[tbu/\'_䚄h,2'njυ:&!1:UFW z鸒j >(><}Dzm=:/9K?bX c4py\RX`2| V~1*sZX2BE_ʢX#;Gd/b@DHb2^6e}C%pOlPXvDR)%r/}\b^`n*3AIA^]e#)49]Bg鐨c:%.QrЇ?~ћ_GO>^FXKdurAJQio:~Ӌ{EuP#IXOv1ޮ^qjfje zfJN}9)ǹ&s|{G^:;ʞ6:5J8s#ʒV]ұX$Ǚ,2r=?=?*d漚9gzެ_|÷c㈒5P^T Ahs}t1K/IRBM|RZ$CIWwycuޡ䦇*c`rI=I@!tGSmjoQL)>$#s`[DKeV:875RڶݫXtP]MWCO_OZ?y=H[jm_n8n4&rfR=B<|*R.* c?fڎ #(O$B48vz!:ǦB4餷\ph^Q96FxS:hGMUɸ仇<*űndb29V3hʲH+di)#+iUXϯp˃|X.cQZgqAdT|tTajzUHE$?a )085>^"2.[ӝ>^rZr+.<]/)>xjv rG+bNb܁<7tCw&/K!~9-}6c`uhLEw_=tdo|tb4]ѷȣྟBy}&mԞ7x0W^?{xY@3MW-d:ϦokY;; 4*& rW(EM5Tnz4,톮 V4 6p *hwkiu7L(~x|N#o ,7(TR7 72 0g@>؞b2h2eXYJhdqUUM]55‰Y&|p3^=BWNsf(hl^Y#dB翜: %4\ dўҡ7c\?|x,Z{HE]ׇVkBzY Q1>[ k#Tv")I@ׄ4LkY:݅n o]*AZ)xB(u*L/J.o:Ui*V5[(+"jkF.u枉,rCkwuK1\T] 55  cՠv۞jۦU7mXh.mW;Dmv7xCANڦ𡲶\5ÜM:S) ¼'}(aUjI^!qz٪|oꡪVjU](*-˶ ݲ˵D!J$KA.$qN;v={<=㱝;!ڏs_TUz|;{Me*W*M.H1 KIc`v6Y19e 2YY#W։QY˔)) o@s\ &?)]tS/wJa \4Ҳ[OH+X֫kۯkݪnm7v;ݕj㫠\~TRphBb},lV5t6]lW Q3>J}bKGH.m.+Y&oJ!j N.]>Y>sgʝc!jA"e2nֿi;j\h]uٖ ]Fk 灾oArj%VJh!8snŸqkt.ײBєhS$ hũ`XŮI.IEǍɖbp˼}#2E-4dnϘEx 4zYj ;r^8$xg]} wP|Bɔum c-HЌv~w/. וܙd'-@:uΒDdW8( IO Y)oȔ"2VxBﳞI"Uz*X,<<'9^F,}C%0S"2;bWoLFTs@!}GC_ ?3|S]q#UH4WeA@0rѤ9&=@aZ,*NVb1G9:D9U3pZk`+esҦ\!ۦ{ڀU?ioTPP )k%(.lNt3}(>4ٚ ?BSS,RdB0]UU0tRba:q ,9A^|^TnqHX!Sd[~1ל!J^0HI LA;UɃ9 )7{9P,PPX'8㨌pdDTX%m"4ICpsɊZRr{tiηΎc=h(4JGd10FɌ6u4%:PLΰwM94y{I7Kx۲gMuO9\qlFxvA-S67'IYj@uO ~[?:r꠳~hcfe%or|/JJ 1zZVP)3>'cuصZi/.><|f ~3[OdHW\~?x_ts|No<`*bؔVյJ5_^G+;*V}jkwmnX onlo662)Ԙ[s ` >-=]ߴ{{*l)` ]6Uc45? {Fg fg͚t- !KE.Q N1T?"3<ڜzb/NtaP>u!:=xto 8.覩[&xZ屔0&̓uxON0gywK}^|N&60$$!(v8Ls`1`ÒOɲeKkW+K2`i_e>L:7g]hWvHDZRߋd HkH?^g~ڮőґ7>AatvsM-. iUrJa4zw杅w kh&XYT!s@SDyB,s Hl:yU@k6UB{W#ы$j-؞-onp%{6dаuou]T Qy]`?{ 15L#eU-}[u̚cl[vrj`^U W+U-|gf;6oNRFEXbQ0lFAcӪQ,|(56!IBWE3.+B2H8#a)gY0ӝi.IB@0vZ6 *"!_J4H݄GpѽoG;p%mF{uT>a=&:iH. ;_>{?{bdEeZ/5Dnv4|Ԍt棕&$)5*4"0МK/Za3Vo 2ފN_O&|EǭJ̴Reg/RqYvݼvpu fo9%ȘT`k~RqkSuVyږݪl޺]jCط2˥& Kŋ8s!:Yr@9$'EhjzUA@@r*8HL@no"-"(s b:`Au B,&²2x07br ޓ UJ;չ 4ћtkDjQ}J1M8%gĜOb:f(վ¥"і$ ش^r׃3ȲFOGCX$pcy<!SFwD \Ƨa)).2\T,dd l{|i'cJJ1+cBlJ )-i%W} r8Վ@_ȴ 'JR\^NΒIt"'T$^W8{57}wB%f4Jz+x_)&9 UH`q6M2ɤlUIt6ו$!yz8G ^\9vZBg@T#ѦPы1w.v"nZO*A"j2@d<)~J"H-*P, (|+.s,;GKɋ%d:/)2\t**[z2m۲]ΓYLҌDDZl,ӲӪ6f_Mףk{G!G=WSQmAuxt*?^_6?ĭt*taғfrb&Saj<"+hlEdŒ$GU]PS@&T+W _ _hNB4:Gowv`*圚7AW,ggnc<1҂G{IT׻¾3V\*fݭ֍-n0^`Wv`y4yP)ufDެK*9ʦt-[ vt-9vFgT^}0.ˆ @`AjhN`O5H>0_iaz?.мNѾ vS_bzk膹;x#)x~r.D.Ǣuٌ?2L`E]5BO*HM(^|5އvNwww >.6@Kk'ߝ>%@\8?3Tdzp)*]z0Nx#v}ۼ wtuej벧#\[=_ċr4@!P<7ؖlX,)l!zĚ? JQ%e7 !,9Px]\ƆY \$Ҟ'N3T/|ca*I45N±49{ viQNzٰdݐu]ѵn8VU^U GUۡ5N@ɋ}W@$Z \]N)x%W f^yWG Jɬj4 *Zq$4 6y^M̅96)!i/E77((VT6CU*R@/Gii^R2ns_goi\Vg<ؔ&ڊz.ǰn.޿0qUЊAfh6V5bYyU~b֋W;{[V}GJe++1 3Ղv3.n4BcuD䍣!JAM1o71x^r0X7Ԇ\=|ޱ̓>T}Rd\<3sJי\ |TTy!BVW.gt4<#Z. 8AMr*;(v H:hVa=dKF!$E$yD/I1Y*UŬ9]UUX˶"ঐDDW~,S,I(ZxTZY$Are ] $! '3mA IsP>{ ]la>47H%WMr 3P3q`+$$ dɖ[Z}>fpOu̪ G7.(l`]aАd a/-0-`+=:W )v H !dERJξGY$y/`9?S+XD!i76x.t&[jsbw'Lpq!YGrrf-Y~3M:a?M]T;c+Noe" ^l&: ,DGa^iZaƦVyhV0l ARG00y-tNY"!t:-It1hũ{/SPS?9thdǔx:!aXZRp yҏ 11²]9+TऔY|YXSQ-feênp%%tmM3u-5QFr:1?LL?@r=)hb?h QxDhτ'1+,FB: Q)5I L\|F'KI(ɤJE4 !'{S]|e,6#BñJͶl3DVSI"`}9=0 gQ4m[A6ꎢB;Xjts?"3LSi(M[!4δ!1&ƖOm2dd[m]JZI^di/LoۙE:fw6@뜪@ެH򖫡nyw.TT9zw~ \ק%9d-1 OZLMÃ9.JR ?C!o "@ڗۃe1;JQs?e':~Og7<4.%)7O~Vb{p#ͤ;Є=-Tk'n\g|-m)W~E%!}Y*PĖު'gL0/򚺴$.d`^Xv9miZgf#_/;i{q,|/~G쒛BYkN}&%VvWw܇0( |򋎢}O,wj>6mne3͍Z.BH>+6yfe^X{jiƛ7koV^^/B(\')uh^}/"qC5IP jPECʖaTM 5ԭ8$Qd< GxN4h'3'Xs"bBj\A) hLlTǂB[04跻6|ᯢ xFagRI.{T QaM"fíwl5ǦyZnIX<.3Q19A:1WgDQCCbOܲLh`MF,Pst<8~G̹ Ӑ݆ RaΈFiD  ^xZRKR)VI*uhENkTΑ]P<6):|(󱹄DcwR0Ch,,³2 b440h'*s(eIS`"6BeUY)֥].J%76he_ZSDg~_ \>z׿|6Ű`ڏفH4E U:m4Y:<.lj^BTfr>Ƨ0F<2^M37wZϧg溡B},kxYۅ7"M_޿>(цuf[.+QC엔^ggpИ ebj l;Uer^svÒ}zzGa~񤇭/f[`#TKȢ̹O=xjNͳ%„G{yz%*V {^UmUS_r2xAM}k/'˔ZϬ4:?h9lIB|)gů[5KErcIHT'_8lM7ĕwlα.v#Yej`uj1{w{% "+1/@:* 9;Id c+G4CQ,4=5"u l 9CPg/>&C`JegVW)e!_^fJklazS{q?7Lk!95x AtaLQJN^]sTr堒Y`c#d)LJYoK'J7tLNWK\JN JmH;/{/k{՗/kG B0S mlx,ݟGnqix#v΅cܪX5J@SJϏ8hQB7?l:mKjrFOuCu1k(\h xOq| F.A\ {G]ZǗ**qCjeV+Zk7ngu ]G6"EgY7,:D(R2W\'#Ș(V}ODHxu,^ZF-q0QuDz?觪_ZVUwmՖ.hq•@6L$vNqG_9<}_vlzU+_/z535 ! g *Mɔ5;z9;ETQ@ֳ#ń &(IhBK.H b>b\R34" a!= KY|4 OlKlf"mV YN4 ;ey8v=;p:MK?wuoxcynlUjEشV~mG >OG~2QЎ4 }ovL[5w}04~Gv>:F{~gyamY \,|U'\*Ouޥ?f 3UKkD='4{&q]GWJb7ƋmZ|bw[o^{ݫ?ynWu%T5Y{H/%o /MkWt'j`ix{i8exaDma<< ΂2Y3 <ߚ_kntCxʵ\/Z0ÈŽ5Chr:~)C.tQxJbP/K9|\ x:Xc;i@bT av 2MvBiMPm98I7; "]WAJ]֧:x{ΚKO 鹏~V$˝7(@Cι \*¶K 4fX>| b!,-Ѕx~G C\yq_xĝ{ћFֆOKpl(9.JlmٮxOƱ!:z9Sv ^2(&C<!<ܘ%Y?&3\5EuGh%j.lXl/O/K7m9ΗF)*]Ejұحo묷 c- Z!i$b;TIme;ޠXbY%kEkdR$.Iq'g8 g߇3:>c/mÝ;s;{EOKk*0BxtŎ1쬠Lx?dZN;y7˻#r[~ա}Z6OߜWա~5t])C1n TZv ݌u^N^j o"(x1vG꺜M>2D?> ( hq}grfd{utG/JIiz!^MosE=MPU"SXWu\M6R {vֲcK{H@ZXS]>1&{# TA7TM"jÖ5p\m@k(3d2%4 S\~cj2aX*"ةJw mwzh H8lׄv:VzɾhF6F*5#Ghq#.滿L`k:^OE|qoFf>鹉=ͳa"kcn %qa,FbN[UJ2-y wR|&v?㝖@K:C%䄟X q4LaB< ieI?ebJ ,I1u8 2]rk)%兀 I;D.`DCMMR1REtऴ;jUqQӜ;UK`K ҞA@hb/N4[_BbՕy+nzul9wnFpnwu-wd͟tfny >uvِNp/:P}߫{3N,(zGq7h j{ѱJ;u))^ٕ,ܯf-JWj>puՅ9ڭ/W>vu_󛂍[I;ӱ|2^60哥O-;A֜q3mk?wɉ~j:r<aV"Ok GatuqvOCdK3pO ɛ㓊O_$2?Jb*5Ш.BbHn흟K;Z[U*Ȋbﱭ[I4t1Q38(N`ixGPvfjO4Q>섨'Y A wH'y\4(y! jN x - jQ7@jA8ڴ,(q]*_7PRJJ*i9 @6>1>fٹ{fw ā8ES۷5/y*4wf~?_U,$خ$}L#>'*[2KgĮoG>x~瓭VŠ3Ť00ԗ9~w5pi7_8a#'3mMEr%#aگm-|@7樼Z -ç_cA \c`u5;ޑ"urտ| UwSY? $+)lT*¡8|cHqaף_p2L,Tpf 950{諭5 CrlM@͍P+oY1fm |l임C$GO|"(9F$4ԙƆ嫳A#=|5%>QZg ^vPƖ$/R")` KPzУ "L=Yy!SVZcz5gqBP=%}K!Ǝ溤e%V րӾ~ xż|cz?4߮lv{<}'ir SaJ[#CᑛRPʍN,4EWRωD#!Qs 8h=W ?݅*`);Jw \l!<<9p1KFG?y%顊K_%gDoRr86z!ߑm6UVvwO:i丹^,|} Z$7 -jtwm. \<'ꤡi KD^?cx؎i9B>6ЌJfd"'Et|\&1JJ:ȕY2F" )jѰW/Cl'؂XbQ**78pVi5_DA04 &3sbI0Ȕ ZQ6 6uf˨F4έf-İ,4&O 嶺\tHmf/3_78 #6ܗ: #dڀ "dJ#It7Acx?vֺֽ'nnF`:NFҮ',Wӈ6 2l<|r;.Pʠ͹(5+Erd޾n.t,"B<M!B"_==6w7ujs}BĔlÅ[tT)/M=r 1]hdiuރf?]MwEZiwU. X],wR !a9@n;$Nb8o'c{=GB ض J}#Kf,y [lUZ +JMԂxսbnyqtqkVn+iSznlA{/E$7Lv}sSI7G>S*|7y&.'2~žCu^;C٘V"\j`<=є)빯>_SD{[ m_Fj`/*Tŧӡ+ix͒4́A.+K) ,;/l[~;[olloQj}nlkOJM{U?~a+dA~T7..26v 1'74;)za]ef,LS0 }A0>Xb$ T!ȈuWKTaaxNR8@x ^ uL $UЪ@SN]K! }s{<ΡbMy <.m_||+d<<-3 ׏FnYb"^_=O?}By儋9:؞*%{X|Aٯe^mwޑAR c[ջ.F0"-çs޶䷇W> JñNSaٲ5!TRUY "S ùo>?؋eBv rH%h.QYB4TFn(iU MR l 0+gbhhUA֬Ҫ?O *`hFÔ &B!FE$/!21N̊pҚ􌤬m=ӝ^w|s,Ѡ &k9L*,Մ. u fJ҂h!Q"O+):4DQQY+ZBx(%Ae Ih&)MVR8#6#$گn MĚtmejnҭuMz͝Wm+t-8/w~oo0-) A`Vd~ ؙX!,k_>i(#jLﱤA9]r%fgZhqrtur}R.`CX%5lCC7[3'].L‹SN<0t3X!S- jޒ͖h(u,tXLverCƸ2ڎ$ۉXdUfS7SoT|vOēNbj{tC3lpMl`⊘Q ^Ө;ۋ:+snimPpt^6|UE֪2_OTTw6:|؄GGΖoy[^(|q i &ӽZy b 2YMC5j fhO!t* t!X1Fi&Yo4ZA@#56TaWxQF 6 sEƉw\QYÞ/"RUKyQ؜$: I'D4 Ҫ5&׎:~wi&bGCR1-{)9d1(,BhHB eX0-l>776$MѬHTJ-0qGOʆiQԾtfPGUKK5@4hX* L$,¤BȾ9ql%$ JS̏D_Ner,BV؊J]30T*] uUWeS+.Ul]^yz 5M/G;VkTyyVċko0+Q\n,ٿq_ z aZ hZv%<:y:D'0HyEH\8-g_(++HI 4"%<$(v~t"#?0մS*3ŔBxf&[Nεb_Kj13im{j弛pq,K89 pf5 Tߖ1J֫/^V27??wޙe ,-j+JTk%u` ~W5釙`(@ e}dA!t.>kK; ;M)%.\ <fpOؚ@RZhq] e?US,d)%CGaƣ\"F-qdɁ!*'K5 n N68ՙ쩋fĝ,_kdf&& 0}OXEFtl|G@{myBÑ18 =7w# >v3xE{WL|5Kagd*rtxf1aCtv1IBW?wP"1Y{x`Wx/GQf8 [.Tzx[ Q+U\]@hͫ%A8)ɜGk-k)\] %MܐJcV( f~PJH.Z=,? !&n*mg"I;X]&odAnf+*N&2QL]w_K)O8J+cT~Zph0d E"mқ{g|Yl_lT[ tGŋWwwv^_Pqm194D`I&|&\>pӅW]?;M?s RZY̶sOb^a&ȹֶ7Ɯ?W3k"2Rm6Jleنm9_M3aΫgn"/_c>u\=ɺp]K6gTJnD!nh*#ZM[nTeBr K tJݣ> >y1A=:s R،^[J3Gc}r?<^X!7cDz_K >zN~mMll4G"U]JP +OyXu]A\Esg|D !yOi*&"^.y(AD?k,If Vq %.*-kzCеXVjS,6\ُ֯7RE5AX2KhGsIp # 56X2)RI Y2|Icـ0ܞzpVTjU$6=~Lr,U2D 󅐐rfDoLZ  9H]g4@61kVn׶j-(̉bv5*imhh-FD8"ȕIlc_J/3gzޱ ;q 8LH:eB.2ȖAu&Gf;3wt#3ԚRe|m8-4v)5LlJ"2~K0QT-! Ze5CW*o=NX̍3L& B~v#*v ]e m*6Wmp0{ۍGJL v/CGf,xY>T$]QA*𦤚l љ\އ A _;NO:Dj#$_,J*rI.Y).ːV뇮߯2b>] ?A-Ɣ iA@kןkdGA6fωJyTR| cUhֿZq;J=%|yki]= ٸnd].6q !th]/齹qKǙw]}eDA7c6Z+;uyguf&ۗ8fcSt Z}i 5t1>rʵSKMHDw䏿|{TSjyl3H]9M !>፦f}VMEaONTL~.>x*äc7*wiBIIw\M<%j@6xr69GDH;WGmĹ#dn|tGσɁŊK$"Iy LWAe*S[b9uNsܣ";؏Q@ X;ȌL;(jȢRe`7-j!  z˺hX5ʖaȪ Db2\ LWfoPFZׁxFUy -]kvFzo,9ZLy(:זι8:/! O#2^ (.w[k me0>{6-d:Qwk:p1!Y]j1SOZdX%ts/ϵl0ޞWUvkWCCaJLpVtOm9%4z; u5]]H?lSg?bR3r&8OlL1 f3faa[B--I] 2g9:KQ}_J{Vz\l8z:T|J̕㵍I*PrѲ~ p>>C)OOt\=WB# b\uWmޫxZ`6}{O/^kOW;DߩPPjoA[1S͎k%w_r[%¡ʝE$:5qcTz tsۄ%V^W$I!-C6=>lf֘MvԦ=-1wBgSᅧ^H=IP;"-`/PX>DZh&9hJ&F>UvM0xLZYԆ=rHyHCixIbdlv|0C1~7lCƒ -P@q1ʨZ)6CC3+IdϤM&.&蠔Γ0·f pU v av ]P^5)%|n4vKv$rƕmx84{ ^l%L"Ĝf=Ύ+}`^]4%8 eY/mNkfpDَ 7JC4=JnbdtMΑyI KWh]u `YTA,Vm<}$oǗ*A BE@SHl$NGǒQ% 𰲠W\ =AP5'lJ8?f%frT\fKHPS0`eltOE 1@*<]糤 h$֘U'Z.vxr[Rd*yzzg"qr,"4 ]W+vKQfsEIfUX.w.hpF \JR,"bd dN|_Z7 H$""5 a9L?F"vńgC5w#nx ¡3Gx-k9l)<5l؆ٌCD:sjx+/zB3! "8pR}Si8FSWlhE7 ir ,  8 vR&R׿Ψgv*OGrE|s d*Z[eJes3pjډCK?r`iВ+I[ꝁo2=w0O遦\wX"Ƕu>^( fٿ.." Hu.hTf3҅ϸMߏ^]+U XXfZ>k[kq'ejO\7xi_އr{ݓ3ws/ݧ?pNYmEbP#ݢ-"ܢ#Ĕ\{Qz3qD}g|o֫J.sӀe '*(@β>j#k4*pc fd#"Mi~I1fikTg4ټCN>  wkq˦'B>kKZϲ NP _(Ԃ-ArVE%.2`x,)ă얇9Rzp)Uvԛm 6Dcq1d[y &ti=okIB݁TDeI<܊dqis\J]C*]MdgDUUTjX(B$\ a!  Nqp{Qsuc ?H{{ĚlI3ȹ:ˑ$KwK7%9ΡzE*ۀ3@&uiN wr+uA3٤S/n[,K$_0TtO0Ԥ~\ ;;eoS7ުt6[bC-,򺙥*nйndt'|5O;Ps2fJ `w 'ǡe<7p=1{+9ܖ8}sĻ܅nq< wbf Y0g]ց&*nX(D'vwUwh?5״_)Zr/˚KEMZ[O;iC.|}RYcթ憚O~^3G[ϷV]8\}bKՎ5^K{UKCqsӡMin,jHC}+G[[ۮu]nsӦ^ ZA (u?IvA hh(Ē +E7B$9PD<{04 'M# K.ıT,5޸rz#7Qt*$W8%utz ~E *fdђ;U-[n~cD-RM6e&fH 13X.H߻RDwWj<˸;HG6Zy'-̦LR-viGg\ iE֝6r=ϭ[^5n=:m۾6`Ob6,k ttI$iN\7$u,˖-ے/Y%|:,K-:H!JI"uϠ(4`E_{Z A5Jowm;RnZ9#wNNIx坩·+/T NwWC`[u?گ =8m cXˬk퓢uZBY$Wȕ7_,NS[>̉'DW:9OZdj.=u}gzwXZ$/\N=&.z.WSyz :LrʛХNvA~'i n7`$+$@ JNj[YJ~Ђ y3 #*@X x Hő~(n)Nce AE8D (Emh 6^zL R8` Ll 0dRLL\ =^pT GŊSQ%75v$ќZdG8Պf%$,oI99V Spv83Lvy~fgcg'?$'~5ؓysocw[no[Y6wSz#On 5q=E9R[ -.wxC3+o);g!D|ǮYdx&8[:ɍ膢CؾmPvROiV#-"rG-R =h44ZAR{{d8m=EE[IG/mB䢳;FrȬ4bաy6?ZM2C ^akax\`i.e{0rIJ 0>[M媓GޙN5> ( NkC8rvE%mWj:;5u:UWo-gǔ-u*]}m{6k(^S/+Җ~x􍧗ޫ5ŭVEe{VRv[բW]R+ 54UhP9nxM^ۡ95p!_?V:yÿ'>C&CzW=G ϼ:Ca#hD X+ƥ-BrCD_c=O<Exg~cÂIx Ł<t!n޵zD‹`dlrVά7*wh= 9R ifHL(ao{H8.}(\NnJ `l@8#'/KbMqJr{C^__H_I,kuh\n [)-bh 6q6,u30cXd$#x`>uDvOmUV+E,[҅"Z(%XYIBB8Er1vlp8x<܇8A ZҪi[iU?h43F>_EJBj'#ё(U r!D/re>'̥;h]c3BQEA,ɠH H"p.^7wer᳴p"ˈ#q d"i!AQ}w˺vlht}NTAdݪ0fA/?=H#Ί8b>2,FrYIxpLA k-q*΄X.,.Ru6ڰ&lLm3wF:<\"I~@ϱz.p.tS?wpӏ"v Ig_\;m`MÍ{fR"RR6*֯L棆LťVYo3CvnR0C7fc|@J:~"v ;lH)G7nyس?=P}-T&ܝӷ|>Cu-.6:  -Kտ;= a& GNs7qSo~Ff2-8r m¥P+tYG濹l%z皦_1QnVm.Vf\Ryʄu#~uo_h h́)\MW@)k &U!W6TQ4{ATZ&q# e49s|sv$0-~ /Ԭ 2K@yЄ8CEi2˓Ob-p2XB44NFm5ꮀ= YѶc A'_(/,jkEzά"V<i^2tS~gXh)qzͣô˜/'7攑~(3{Jy z5HN[n㫳K+|C`n\It#«#/2fJb>b }D?zU %]苺D6{>d}J Ɇ/af6뾁g6ԜSZӹaNQAy Elجf 7S-| IEͤ`d`ƆEGIwq]~.>%@-$^6m׮7EPvKH"ْ־[ %Q$%QM)RCrH9Y9>CQNmz/E\`ܙv7BU~BqJLΐͲb[h59ھ)z[pc7B]H*dA_j%r#adxJzSʯɱ p> O0e뙖.$2)*bF'$F+Y.K_&d]Rl`iCu6˒-s`#Zᆭb kR%xqb\OG^F-,kns999U `R)fCo[$MɫlA Kmն>A,KWe uضqMm?7jBwA&K%^y-ec8'x$a4R Fݵtua+0aDҎXqAw>噾1x XE]!;ux_<=\k*E:L>9+,2Mq+Rw|[ܹ5VcLzm:7}S >χm(* ~T!EG9:s+ԦDYowQǷؤf,1gVD"GW9-רbsz^?wqfNTĪ*hD#r+^e̗Rm՝3Ŏbh?>2;|9fc.+IO/8vG ct=*˕U2&+LnN{R#d>Ymg!'܏Ʀh1֧]NC&Ih # D;B>S3"'Q/uD%4dSP5NTyYu #D܀z3o?L/> I"ULH/)1AJ PezsB"!b@e :մ!ekd$+#qdL~ cJMI)ڦ$n PjaQcE=c8(zHf&hudfDb 6dJGABHY2fX9֋RyXD|=(cKykwLUcxzݳwŔ=|ST"TfjF+$8qGQMPhYhz}}} pI)<%XSyHR_ݺs~snOo7y8ǻG0?։νdTjo_ܷ9n Q]eaأFgz%@$'KnMQ^N0Q_h/hx :4R}k1Wxg}uOzqCC}$3R^}wyΔ^@L@-7ͅGŞ{j/l 9wgY27&#暡IY2,H"Z`5ti K_\l ܲTYOJjo,w[kPoåp|Qzje9!jJ%V?nd̩FVQ3g "hwlز=O{Pl}$5m@bKm `jIb)ao>[ XDq5>A7yULE#8 Eی+ Kκ5ŃnZ rfRV14fi9k+k{?gm8c۴XW>3{pkŲoZMCxMxQE.n{Z߶ʓZU,+_[tɮjo?pţѹF+<ȸ:?*klkZ=aޙ4B- 7-YB}/~fk>w_?:7x71Kq:5r pͽs?GMuٌ^wä/TSsαdz3 Eώd F҅ƫ*?: yϴUN~0zOB}yx#=k\x-csxA i^Ӆ7\+V+S6UQQߟ W2iG6jD9C(-Op`љpxajie?M4E7]W5]UUPT+ɔĹxe E%T\ťg`9glx\GB+$""![}ʇ֡n1YX@:mK-h@, l IiqIM4ر(>$(/YdeADrHH)ʎm AG݇39ߐ3*+-!di.aϻ1wF-t_7;3Yq; 3Uv!yAII|ܹNլ 0e/vcЅdx8oQ6uK[#y_Zcmɾȳ{6cJ|z5:r#9~yяv 7 \ '*Β;Syf"f@`Ptxtt|(C{ Ўp8c`5<28/b ,>Bl!,ҖXArXƲ g2(=s@\,$ҏcTjB&in!G4zFϬq@D.1BZUƑ|S@4&)dx4*գw[&Q6xp,ʇwpH._kowpz=zo޽B`]W_G^=l1]R]^G{6 {3GsTX%ʳK񱫩DʭD  `x- 6ۙ[oa&7i?ڧ_{i!gyk#:ՂrImNZYUXe)W0Ŝʅh)`f3Q)1jdԺ$T*S3\Q.8ʄ''\M~\#NO6ƹm+轔q$k bYSɁTOg=r14lzy lcZih)-B(2Cz> ,qzpLGi(h.'@f+s-Q ypT}^lO39ʐya 'xLeŊ^9pM[dD2+XmoW"H6řQy*hBc˰3KZF5DFy[߇N䶸gbϩUyEJ`k2I ]lgaӃDt){|CywuO,qۓ{,rZH%b[,(.4)Z-)LH&]fw#BeERB*j*WӵUPpɄϭF+Q5jx.Wh֎YMMb(FZV <2Uբ Q.NEbkPĂmFnzB;+}5>8QgI+',n &z]?mwJͪi&hhV$IMB \0Clb|x<3ۘlVݭRmvXU}ѣy~M7;ʮHrM0[2zbWZLP9P'Z7[dKU'K;WVf'n_>>z +Xyr~a/Nk?0֝1|Aa^ϣr7_O5sD.876d! # ^Ž®Sp|^4l1Z7'fļ );L''CUϹ.}8w#s, &9& ; eg΂*OnYF,m` W{J֞{ssO C&]L<˄>:_ŝdd?)dMOV.JVĒ?`kX7S$񄑈{$:폹9Y)Us-Gq2ZeuEZNIҙ/:IÒE(ry]+ۦ ,~nJ񄌮24!#N5G:FD0ymv6K+l~{ /[1Q_A{q-ijBF aU{'OQ!_+wa&A06Fiy8!9X C։D_s6?P`$B+㛾ފ`uoo\pu\u_ti\ {o S 2KFE8 ~]^z 1HN<=d7IF4uHo,5O Hj*ReAQʫQrY^VŜ*GVtWjVT?~!-> JgR!+NMcHԐbJ ∃R%y@Hq@s?حi~y"zc.";ad2$R&|5ߍF[r#&f k6(DHd@V!]RŽsɭMfs+(mCti:vsͨO…KNvxxpP7v=T}sHcƥB.}PxZ\:emx^uxfB|9'J.8dWCb:O*弗 rrr)[p;'Z#Bn]fp_~*(LGm:fmB#Oiʫ߾}ox·{Өm[>`s/-lXMA;ogmD&oBO( r6b!"itP=O/s_9~uW=eg[񦘩iS? Me4ыJӁP$B(eZhұj/J-4z!e@y˵CD-\%HwP/}nQl(7&:%&^ qۋ@LpyepuěMdu(Kn`x32!E$T{b|YpM—D.5hoE80Zd{*{ט*_6fR:lIӘ7`;%KfP/iWOOfj0U"|Ԝ6DܳK]Bh ~B jZZqmrd$by#}`痦ؙ'zg 7sT/M?Xj&l<ܟl>x֝RPZ*jN럌nZLNn̬jVS3jNչT6iXOYѸ,0GmiFyZtV:>Gx@gfs [:1bKw=7u^ɤ2n0mI@, 6!lM0`0 Iز-y-$Yt]u6 /3K?Ƕ3g|w3ߙs~'PA 烶 V28j O޹s7C$}\[3 RyإBl@ȀZEV+|%x3vf5m]3쬪DָAƊE2su!⁉O|bIz/8q[+%'CL'w׶슼]<_|8pn?wJ19>)'6ғ;ް{tu𢡊Lu:On廧BXNەR5~jW '*y&m>2Д Hm /Aػ&c/SrΊPG:G}c1\Uhvy+ʇN3/.ãcf %Jp7oW?R"\ ԤRI[|6bv< G!&˺hJP0b lA  ;lg13C~.̲ 3y\h%I! )sm4.p6-CVWCdEK )2b:hcv<"ev|ނ '..K3f Zc?C&t1%om/[ ;}.9>k=LD 3 -)h}hԷHO&tIG= ֔e%+*z1в=}u5fPhnSte/F/!5ڑI[n>5]=Jᘭ{elNTJg讳63C^JnITӎgb/Ɯk]0cc9  tKB@Hhnh4#ͥ m+y?<}Kjߗq \;s&(ߺtEUZ D/Ӛ]iX"(g4뤠y`,D.FYS Y4\1ac9p2aV3QCNz71Y!ID1HiQeIl/0Q73 !FxGE*e`շeYMAmˇ*+jhTэCQ˕7-"u,P Gr$oe9)S A R=rL L\]xT[/!x|h=3`wQ vqLIO !Kf)4'b/9X`]>`ȧlZA /{ְg@ddasLXVKJ"d (ElפNyz# 0C6xP#EpF7V":2HjU@X*\ց:oIDMBYܜMyTTWTB|I1mF YoNkZE99MY6{z ![Rә8L2 {O;u_\FĄ>8!V^x]Ep0l}~fY6܃ vDC {=|KUZkMt]-ʏ.T]˲w114ݗD{h3,͐K$aQX"%t̀jXeI&U@\LL q\HExM+Ħ,Q#C2HBQuYљ q1c0bsɼZTEN%4 evz56q-4r#!CO9VZ&Nc ~'əx~D`8hO-q rJ7!=_򽟟~~;f7)<#_GɥIѓJma{'YI2R/+dsu<ׅ?}Ls+k]%٧ëso/`{%voc- xES،L!2@ ucCBwbH7͓bL(6x1ѝt]aS2ubF]\lO[ȂJ.Z^FH[T+ZWb^QFo`qPtB'af]4a~{v5%/٪Żv*oRkc,`,`/>1F :@DҠc4ͥcnIذf7_!<[2Wt: NQL bqf7+1i,R"_2oqL96a,Hkqi_xp b,{(|,B4w$slP()% ?_Epe:)&GBDDT9V޲o&[)k] rN}*ߤ~ξq[퍵?~wxW8>g߼+-&ʴQ@\b-hiJB[#|wOz$l`I+]!ng-a98pݳWrmHurݖFZCxxC )xا-_U[%IsagƧh3X l{㤉;sb)8E3uFU*ϫe\aoBO !xtI xkfb]I2qi,IdbWw#cO00ƫE2uv*d*7=c}Ϊ˛Ͽ |k^:/Ȅi%)y=_w./R &4G)W\?5UT@vǘŇ{K KsХjfB9tv")WeC_ &tZ#Ӊۈ;vfLxyp=YE+cޭ]A&"<FD́ QӁѥ`+;y;m@j*2JfS۽D\0IJ^_}4ڼd#nʷŢnq_CxdimZX@=dHov$#h_=W|}kaUnkƩ-& ݮ{IP0jok~ysJ BV>p'V|?WlCbJ$m0hЕAkb kq:Fk)":S-aF6i SQoH W@lD[`d&DOQPy 2 bI[l͕jj{urF,,*9P?n--%Vpp!H~m'|N6gR\(ܓt0 Hݖ0OLo-']ۀ>%`go`#@uS':ӪגY>CH<ᘉycWх]C43W(pD: R!ZÍ{[N0qT,`YܵAGIܗS=⸕blPĘ,$)2$BD@⤑ W$YpT瀫>u$ΝyE],0vT@W>-f+2Ic?ΆXp!ɼgƚM{S|Յk)R@9N&;\:xta\&)iphk7۟N_3}`vO*1~< :;U]1{yu++ԗ+ݴWTRyl{|(^#/mt^5%Y&z 4J\17]m(TQpfİհ}ٳ8ʝ*WH8,SCJN*{8R"eי7Tۛëqm{x97Zo^ҋO9ݕSϬ /HWi~}ZIxnbp$^ԺYSvY(d*we՗F*$;`AuGWqvZP EGII?5oKKpdW*ӕ&`b},"rYlʳbFA \m:3`+yȭ)0%D<*;<ǥepR]\{r֖v}ߘ',ɶO=X.FGY2Lb~.Bvu|=v1 &rv&5h>_}3G룗–?KjQ?' 5 NnWxu^EcT.pA,oO'螛lʚ|>y]@&rK̪9=m>؞@"|7j&7Ł؍}I<(B BKWF9))9(SԔZiM%\4.tF@\|Us2i"ayXh]s j 䚖5/ZۿBc)__X%4ܟQ*ۜഌTb e^pZ,cLt bfr.SH|Bh;B1".hڽxlq)(R ^F]|P,T!eTU*]t¨VFURenW1H-} ,]+Ҿ.F}~/ ,V=hhr1Rw<^9_M fW?x7וoJٲ*1pِymW&Hh)z*w!,"QHjz=DME.'WMtɠs;B/=fmW|sRfY*z&l:yv_?sG"D~:—=k8{)O*/_|CdMē{C:6ˡKp;ؒ#SJaCrOf<ÐNYĊ@;bFx5$Hn ǤWY9㑃n.&b;S )Q- 70Tԣ) 3k]&} kAb hxj,b z܄ \C 苌BX/Durg<ҀC|/7>9u1l6М4}67}ȥvz2l%#Vjja6]Ί_w _Atħ9T if[EoEHnE+O|S9s\$'Dg,8"1o~q^ (O{}ᧉ/lLU*w+re?pk<?in67[[mfjmfsm*Abݹc6̠[\>Zo[o47_o;ug;}7"wM^d R_`+\t3$$+ c LlrN[,ezWr//j` 7P?KECziphnppDj)GwzXxN蘨4KE` P4ÕbPykP_3hQtuY9h|/jV,rCANHKXN88Nigxjvשq@9lsc! $YjծV{h/i%tNoif;;;;ϫyM[6,p9ˊ恌ި.f߾|lOsLx- c+pGm8#O_ H:@+)fsp)C]YdJpF,K t&9Pqٻ\`iSW#@A9b'n4oX_эTك+@y5ƃc񑚍&s/Gje*f!3NyF0`2I;E0yz6Ex ۜ{<^};Y*W l%+7=]qRe)Qk7=w|˔i s# 4~yQs/6n hsLW:/Yj;a P Go hSH6vk=elL>}{#vn!)sD(bEt⣽tYUuo?q`Vbmܘ#~ʣg- ,vhO \,3tʟ]l+~߽Qe69£̿uT?O׊ (~wD\9F"`AXni 4Q-? 'ctR@,{Qɼc !n"9+BxБ (#LY蘰Xh7ѥ>ACvm -0d)TyPeLv'fMEl\Lj6R+9x‰8R։d#8-?&x0:Yyny1n,Źd{{OTGL߅hx.^oLݰ X!7aJ:h_zݪmp!y~[tSx9ז]ζ.@,hQD|Ksz0 =BH`XS΢) "*׉& >6ڞAq'+%BkVJcd0來:? <8gS".dB6`Fty7eg8I{ozxVڠxC3%E+˟Bkp͠I)БJGE%6Gؼӈ#s+J/cPdEv'KJhVN햸W%_)#$; ErydrTʐG eb_( Zt?S/oVݗ%j/ɑh.@t]P{(xy(U{X|p~hI?8Yjikl Ā g6VzTM4RuCѧ|(-NOYWWjp#]jOȊ2r}W†F݃23LicjzTI}Aczrs}s1ڏ{߿z7{V9VS1eV%c OY, vfJFU_ʽƅeXbkw-@Ot'.ީ%ǮZ%>64u3kǮ7`3ޡl]UI+b{ИNPeRZfiY<$nm4U@aY2 a3]5M?v5u0e=#@W"+*|1K{T_C|Cg\Ӕ+HSs>NGE;M'5Fy0w9șERB7$Bo TlC ~r3>Y@ήwy2'(H"pv7&>L`9LDƩ[6"S ""%ɿL\#Vt>6ۓpu|XN =^7^lΐ3~OF;Ҩh:P1@5@Y3’B`&@`d,$NŎM'^ھ%q2oUߨyu@ZM>}k5go 17e@OEO%)L#rGhfɯ_O&nlu4R;&޴}SiA/tˠ5|~B2qv8#[Mfv8ylǖz Id ,[IJϫvոCm ]'.YitދI5:-LB97ډV9n9pŕc=ު_˾3)d18o?}jلt֦ucWhKn|#:Of {'I\u s0r7!4,-j貤*ZLKLQr`YdyTdBC<sh ;3 gi wW@ ͮS%9jIuU[.łXIT)լPbJoe2&E(K+&K첎sW\5V_iƚ X镴VfK yƖ5[\S^ 2e{cꪼfz]~, A1W|94Ŵ[jCp`;/śvy{!=:BF7r|i'2C߷'ñԼrb&RDGK^o#S F)$KT~:q(Ur#+iӐ\Vㆳ~S]1'q=qL瓶Xmr˾E6em=:<ц=hӕP絸&2ack f«†ϐ^i{}N ՐBdJ]K?<׊uTG{Lg"D=+E@*zI Q (#e|nW88K]H&_E6[up.DI*A( -Pol<4é=t0F]x*}>8:x63IBIȗYK#R̯۝?y񍰅ɭތ%vyPv@w_E,7q3im@]ڤ9x,,>L gV$!~~ !(9Lj|[:8'ACNw 4:s;aӏx)TRZ VKIoQ}.Kn\JIU rFJ."q @$Ť$dlDǥ./)?yUkhبtHG{LLR]sxYzXdPug7-ZN-9r$ jJaP8(G=PKaP,jGePTlkViE^:LQw.uRUX*he}B%IXֳeSP*V.9:AB)QcH5d˂N& It6WHlG[˃2w#A ji0F $.rXKdVeƑ=:Ge"bXLSb`uJ"TNVsNkae9Ϋ(f$Q4U~[Z z]!괮|Y+J4U\y뻿@ ʲEPts9I&6:.L7y >)xw?pxu's( zۦpk}m + "K+=ڰug-lv}i#ap1Ymo LԓJKf\YITJ|1a1/nh7>)#Knu饪#bAMt75Ad(/ mؘ\$>GiڝB3\{Q%4v=A3̴ո^j{tm-Qsiզ,6[zՙ_?q@گ?ZN@O9/۪v=F7ir7=$\3|?TƍJy.6=KY(E!w0}sNp#9q6R`dhe*O_Lj?zv:ŸpJkx-R>'8uZi]UIR+ ,<>DPͱ(Z= қH"E .6/Ad5HkE$k+oba]ǚlj1!l\,?KoDwf C֟LĞ]K:2ACɄ@,C>O㐏_;;}};dž.rᛡ~$,zhIp!xTcLVɜ+G);?ǟFiA;i>[f|mRYoM$E*yUBˈF٨e4g@ƇёF?fy O< c 2Q73vѽ=8s~8"@_q)Î[Ȏc8eՉ%˲$+Rt-,^")Hj嵻\}syHl)u>4EQK9} aa 0̝TՈo*um(9Jdykxu(!mHQ:3 %]ݿ©L͜ء޻ڃ=H;7?~7 _kD9F]X53GXe,+}$8C؀[BS)DN ?;x(08U+'N}LҎGSѮ P%t;$8x?u7}2=ux62&2/ dfU DUB"#h[ӌ a."CsZh eP J|x86Q-5SC'-a5Yg9i}mXppY #,$7smEڱ4(0r⏏7cdX-hoEF]\хxdG OӲ^ %V(ag 7c%=xx?o;6ہX^еQZ`UWWb;u-[Ԕ{)4MtXR}Z $NE Mt^i0Qi-5fO3wՂ_K`*5r?Gk9nZ~Jr<2htYVsn۝fӘt".1 P;rDJΥ$Ml/3 Ä1k.: 4Z}uIј5")yrhLȥ"X=}557+zQ+H6\T=\, ]nHJ=NW \,SA,p%I(xfx=$!{5,ݴA)rQ7XXQyɘSU?*"ш(,]{RTB>#$\dtX@&'Cn㝲DlFa?8臽5a'Qm5'"E\E4$B 1\.QkEƒ,2eEsLj᳼Fafkim֪G[ƖJUc jO~wl ]z7HWy#i˧IWߺkۉ툳 D}X 6,]ص_8{sH,+}z}g/_TWLwL־oz鋇U"l` ^=0?[X8L˱%:v ZmמAG)ԭ𣔽%!Ue?m1a@-:H[m%i4sNĶ|Ȗl˖eٖ|(QH[$S%]sзeiT×'G!Ŧc+ cѽXc` PQGOz3HFZz3GW~;|14~ U|.;O⁸LJ"TtO?`OܕZaPKgRO{N=8~w.U3L`~좦&#&nur|qCe/3Sq'QUM5znV!s"0X!A/sd;o\ O ą5 s@݉Q['1>iZXk& 2%AwÂ֟$iWs]6hN4_[쏏kL|o=X@6f^mjGZ1߈VҌFhtk?QfGPctm͇~{1I,iznZRP٘K&;)=h~8=]n .s#}!9asщTA!@~/3e5ɂ΁D*^xphɲyYZYpw 17GQnz&y"k ',a$VejݐL]j}4բjU6?~\Os29+':%xƎlŠx~) OŮ3y6D%L6i_=.gd:%Cu!&nV BP|a'y1aYOOFE\@ hBDCTH'TPyLH{lF?,@U+5pՊ־3L`Tઅ\UPΖn3|Ջ.]ա>uqKU)炪T|-8 5&o#XX+|[@%/H)9{fh{ )C94݋6FV,yz!Xͭ`[ֳu^-hXa\UgZqgg6>Kx \dp?SNI$?ykЫ&Ȝh sN8Kl?a^_% '3 z% \Н9j13y)7_T0|6zI|Ƿ=x}ZoGT 70%WĂ֪k?lt$]`Gl3 -ih= kY0d\r?|1SE ( PuST9(s^;<9uꌧTwz|@ynGtϛPʜ÷r *,_UV0Ry=<|*RܡSVF@,[D?Uz-ODyS-M?36q1~uxf} ZvDŎ3fv ָK:>~z$^_-h[٩EYvPz`fWFe$KgCrv:K1.7U:um n_]쥏Zίin_xA\B"T*yzof՟,C/iz+Nm3TGUg0^{ev;` GkՒ9>*S(7t]x/ 0jM4Id&Gޠdy^tcيYQ$g96$A8XzQ4$6QCwomU9D$8񥣻Ʃ|$Ư b;HVp+ tH4!Q!i# y&6xҟhp&^d AH6`*4hv* .eFD\AswGI Bq95W䑱;p@Is[ Du ⎴H{໻_Yjۣoǘy(*xBvβهW~fO7.m"'{"lsOALK?RJSǼ آ#l C1lz XdPCH\+xI8Ơuҭe4!OST*Kg9&$W T8ͱ4X6qAx?/Zsф%En ćbgXl! tP{ Tu@qM4g6^C32Vu1~}ݸ֣[0m!1ؙ',ĶtQ7KdΜ%:q͓̔es/MYOX79rTy/'Ba\jGĊk$dϒq?2`\!^Hޭxi{ }WBzEȤ6Ki {yIѽގ EsKs#({gq2ld#-=JbG-lH |笽G~#~WuƘq]IJ@qs,?'Fʮ{H^e-ەXԚ?}7dpd68ַs|6- BL7|M;HXK6IgFlBp.ɫj#[=WBDa1qqE|l;_~>fz0)3T g~2$FMحhe=IZёܣZ^lM(YR4Z8ΰ2[͉%| S涤RGL2TRKMo"h, "pM3F1]o3M%I]E*q\NxFi% 0d"=AU\Mw=7߾ag:L춝eЖv,(r&ܽ!@H I@|#7;wǎmٖmY$b],_dItl:>_f|#};3ǿOQ{ ?1&rY49v(,yVz jPTeXޢJNw13Ց ўy.pDWܳBQ^6 KCx_/=mˑSXILFg5 /fh 位gט73r-1|!7W KXtdY15z2 H'ؒ*T_F늿FΓ.T(JE ]=tXd39|$E&S.ʐ /S {O[錨0U`Vs=ns;>;vn0[  6z5YU!M)mp)WfsAфn\;sxUT˓=?:Ѥs'|?u宇~}Wi1w5͚'Tvsv ֵG3])"KИDޅ]wj{#gHG7;=y%D<=sgvgWڟkCz?6td)a_W_ҐԶsa䌟OV4{_#L\cÏmw>o?J,=џ>r?` L|2ș1Pٸ$cjm0A*G}ѵXr=‘?ԏviiʕ \5=v\ʽϜTHD ZHTԍZ4{lvʊfm_oucsJQnH[Q=c(M T%YԀ%-WZn"ᥘ0l桔d~r.4 ጶ#:tjm\\{:9)~9EX`<hu74m3m,స8z;4t'&.%7cDPCD|u(H|AYd|f!CxQN=I',5'f)?,L&49ϧ $$064@5# (Uo}6Z/aDI:?Y^_׺#H3!zY2a.I~݂&~'Bw{vo "$he԰&RLLnًH9 2XT%dcF]..a)fq"ƧrD7 XL)pJ6_/ d¦e.,om%ׄWfi3̖\h*Tc8zF&0 6av:}j??tt;ݴ4d,.MK M}0`}ߒlYaɒlٖdCm2}7E_3W?ߌfDѠJ5)*3/C[lsqieaE+$10VnԝxCX7:RJ. +=POq;4W&"&4FN@c>mC  ҵB~ujMNvCk`H6@L~fH4,}7%6k&XO,_*2/sArWoOAJR Q/$nd=n؃U|_yɈMjwd̕ d\+V/vsAg6Azvb3`hMP%=̐^9{+@"]y|015I$YQb gG4/n*jKN6V/f5Qs_R[$yNܧ2{L(њt=Cb$B03t-f5`2)1ި0DqOtÉIi֟]8eH/u" jk,O\ef1>r)jq%Ol=H>jB@LEeŽlA2T^ސ 3+![Mq}D}veQ\S ٛSwx f6zjqM?w_YZ]J]\kim?w BkT7מ4]@o_Cm[)EGrzt[vǑ BXZBgDCk~6 x-,EL.Ӛ#.bh|: S0a& &Zܵ.hۄ4\X@~&zEiy858 gz9mPn 6 f`w];Gy8'УG}9:(˗Q]<4v9*.Yx  a!Kh- Ʌ~AV~ EK󤘦㹽6>DP,\V*d.J eD/$3hp-#`gҮƴӰ4|$dL`$ku1^N,Մ~O'z뱨)S's>\mMuԳfaCFT:ɥ:$b6Ͳ|CqJDp"˞ ';E y^ ]e?[%b!W(:"\ ]^Uͳ@`p.SMBd/p 4DQvyYϗ,Af\BK2P %V[*g+wZCX)*iRypK݃+rV͟oBX2&3(4 uWU0h0!A_ u3s}%Ozx-=Yۅ;wrZqjƹU s[]X*E!Y74S{Ux=i|}u#f5/"TM6/jo&QB[տ0{%8+>WUL>?0cw*G8)wFvFS. Sw_̶HR7;qtfzrW= =w^_w|+Xue[1#%CEx|IHARU7qU L19^J,m}>ol(g"Η]- %csʊu੨ݣmD`ܒ F#@5Ľ).|b.+gvrI:Du <ʀ%owkcC5j[UߩF:OW厲Y#WsH0V+&< MICM좟>09 8ϦYypvH*_%NrecuUKMV !A.dKxEy95朗E:̿鮷&3}i/]ZJV.m(, K%@.HB΍8vܰ;_bǎoc{<!$RJqxC;3HG+H O QtĥJPᄜ[O:::f` F`y"?- ˂V|QZ)(3Z,OS#pmX&[m#w%|rz= f8p՝5ne>q=q е4wek=֑tDJMm9T:\})[Cꃨ')v.,F0]<\ar?;[7{}az$a0N؈sT6K|)! hM~. '%'I[L }S[V&!ۘzdqqA=!,gKRIan5MeͻwowoL4ֺPo*ne,&by:VbR%A[<\~~[U^oXwnO*t`{7f?7uPJ#=0vх!YHw=s|^jJv|s9ftCb 6IWCKM)K#4x9 ΛBX8L{3hL??`~ԝjظl /|;?qp'֋5Z_7!,uB-gl]r\Ts19mp6T3F&rH9fr\|!i4^Z (Ycx{O{&*u>9t7z1 VX$""`ӂS/ lGIXfzKEsEgk 8it)%Vs4sѹf|s'ymdt5L"vhWl);ZflEm pMp>\ U蹓D"g C;5`3LO}4ڞR nh!,/Cäc~o@+# -OmR)hv%Vq.|~iquPukby35z#~J"@Zbs$ 9D1GmvGsuFܣ%_5^ցqD'x =<ͭtӽv.0.1ƥsE<)4]7`N>$eBA*Dև?$ `iT2ɴZ3|I.U:iͤ<" OdEX^Ȁ-UG)SWݖu!ibK$C jT+`^ p! ,R=uMC?JP՜8q۪Rvj-VjǦ9sN 5ZW?5J՝|qX)$5aw,Vj3UoKJ5nT( ֶUDZ]*Wjr5߈GPj1Rh s(pHNb `>T*(F7 aM:)#$̃ 㨰FQ%٬ad %EHg9>" cBpMl%5Zk'iӵȪ* е|H>63uQ?kvQp &54D [\zP$8ЦSNYː-/?{˽\A8'CֳK^fß%!"gL3Hu""Tދ6KPڻzWo/~77~I$Ÿ.2STlxB-謥)""8F~{rəK#gVo 2`%Z[嗆{'o~>oo!ΞH8 NRT/[Jv[ql'u׮55 YccNBs $N$!{͌F9tK؋7yS^oT}ן~SW~u҉j9xfCq\+jK"YE}Hsg_\Q*L1ˬ&Ի~U(NR:X䟤Ttp.qOo 8VQRD0,Bi!\ R^nO",S"OGDԟ򺨩m`9ޟt,p۟ ۫Dw>0yy hlEۣ_nMD{N@a!nfºt H/vϽB_ $*!)D`G&`$1 PqTBI-]ٔ|=%,S!n gk"xBM gM٭1xgBFALIY6P ꎂ:LI|aj$xZ.9 мhyax43[$26R&Bd`LhBGc@$fġM$aeŀy` _jʆ tI Ч\ u{ yQEFБm.s3CRTfTP"8(k{v&R=TCmt_GeTǬt_xSU:sfhq2؃U 3Cq \"&ʉ^x~|v @cXUޑJP&pCBkB>Es|9zeOѠ%OKhClY48L J?:ӋecMElXx?ȨP{!8@Iyr -?#En֦5/I3p2t%_ՈIΟ?ػMQdng(@0LY`I9>u8Q46'`Ϧa~7o;)0˖T=a4'F30 ]">ug 'fΞHW*}HJ*T\$.0 clc|`$_mɇӖuZHc4f43fF $c^yJ鯿_W vp[w,uE)rWrj].(i ufR(B"fcnфJ*m 3NnR˗Y¶F?ŦP+2lf $D0m}3B|Y\KJ9 {Vh0 r^=C'i\; 4n:K{`3QmB-  ط\̈BSLaX t)=AulK:.Ȣz@\Z5N&DXM!mb^;b!KuR鴘RYځ՛?S5?vE0_ż{>:7:%R1Q$e!!R|նޯAeF27,c SQ7ZvkT{熎akw ӤoD9"e;jm|Kj4qE?nΞYtfc "i_V)T!M~wWm-{qvETfK6nk6o?zqVwɳ7ǛrRK_nٳڷr1;Η| s}Kxy4#G-GGDνX*nj)Q [oC:j̷F>Y^p!9jZݷ^R+/gde8_۪e-mR{e[lG>Ҵ~f0 $>Vk"S@y>VX[Cks2 D:bj|ﻦt֋|FHևJ) \-:,el&P?wpTr.nj:ܨ/tF ˟8ԤQ T (>g#Gͦ$k1מs^E=M=PE ^kjrm\ s A < ?F,n&æĽr p  P *?WDNl9p%dMނOȆ+d,p58g䵸赥T=pw@IR/j''ס/Sm>"G 4.zEK~N 儑YiF ƏaL3ЬMExg0 4BH 'HUQHDТz_RHK$' 'Hx OD4 AiLr XDlC&KAHJ^^!6ڵG!ͦ[z~59G|0sEZf+IYX&2}r"ϺT KAR ~1!:4fi4d6R(ӕW[7/_]Ȕĕ9"D /六RPY?]%ʹ@6pܳg3.^ "'|0|<iN@5%ULF8ϬPU(Bh |duҋKZ!0}vvyxc24FkGZٗ#,nf#rБa|oC2nQ!,\L7ʋja K"f c{| YE 텕A8b%A7YHJ8$ LQ@T@G8o{:Nu4:Hb&5ih-R]r]+l8dդK,ӨLݬm xHTM' DJf3Oe0ӕ5ˏvWgQPDB[f{{~8Cr-UwyD:Rt֚m--ni~Uޮ7Z#w][;-~n4tiJ )j&2iԖ̲ۤTkn4sh4SUwj󶒤V*[#8jnԜum3CWɬ  C:X{El *)*VrL b%(N6iAuR@y> LIXecx ' *ʐ,ՒRJ&Ƞ E a)P7jzmRkns_nE7EtV ZkF?֙U\CQ d&._pfŁpԔâ8:/y/Fi96Isq Gugߟ8gËHUeH7|l/Gν75xɛvuJURX@"nh[5_pL6WzNٗz\+~tڶa2ԡ!qRz 23q;Ch̍,6WN "im:~!\TO/; {J֒*5-AílJG¦Hؘ%s".!7i2a'XclO鎄3ЗwMaxfZמX,̏n %#~:C \HÐ?P(?K-)CE j&`fcm4%c%Q A8:Ʋg N|Yt-C&,7Ú?HY_o?'3&gmxn pfJYM|N#VmDT+0!<?ρhz"¥2^/^IjcF0:X/6RN pI."s#i.%XmjHPUJh_m8? h ɚMS$H6m'N;v4S;J|ɖeYaY˺I"EI$˷ݮތJ{QŃ8Hc \y6 \5-.ѱ9,d\WMD_t1d wv\'BžZ&$a[ xJT'/#K,-DV+j|+q84?u_+ %4t2@Qn^Q *-iTX=ʽ/XK;[=/Ɣ{ס .;>ZH7r4 `jtHf O2]ag= 4$~=yR>D݂)Ћ-=47ŕvP*bKtNNĞw"PSBL@)QD+ \h'Kdkԟ+e $> ϒ:Љ,_s9"{ ݊N%OZSyՏ7^Q"m灑ؕcENK@Lk"s"/HDsg 3dfB ɽ4]4ĠEX7vϖ[Qռ%!s1nHړ!4r4|1h NP { s AHCf ӎ" c*ۚZr4 Sc <%[Nk>% dZTNu{У< IF#F^2eǃzt^w<:-PԙIi8pXBO> [!"+s d}3K64i }툢Q>b %_(;u6/J5 KrtBi],kj3򚲬kRQ6vZu 뿬'*HZ1禳Œʜ(Iom\*\ F*w,+>zСCfM$yy^JGҞi= YzШ,a&F(esNhBzԧCVZ&KiQ`X҉AYļt1;SDGrl؂\4˹vnsr^:83Xe!UFBQ,Hbm, $jj\etҵN}Z6[su~?Z|Sa 5W{VzW!k2Ƃ.}2O&Xu_?S5~~~ |x{U}[ey#Ltgj3#0w&SojD3|rϦ+n7}}ůL~ VWώ| lsՌOS酔;hW D 1d < 3tF"ߖ0A29[]@"=3/W߮<&Пm"'Nb۸}EQ$@Q9$@;@m$뺎alkR,K+Q-BQ⾓"upr!)[c;v@OEKgS~ ޼ &gKww?jn4' t;.]Yܭ`Mną`.lt% h@T܊PYɤ+t0 ['Qc+vXIm- np ]tUV*iP9MrG?Fȶ&Ya:u%5*MYx~=6q ͠1Ip$$J@I? >ǯLY={Г o@5|Ik\N [@;+f9A3A6 hD?)0$"KQa,Kk8:YzW0j )Lc"Ċ! Z޸Ib^,KD!0jS=X!\xwWw48=M+&Nf;.Ke  is"Cu9R4##]Œ\LO~2r`p6bAHpTH"pGv&9Ym"]O8nW-U)7 YټCX o9LHF K6:w TH>-Z=h`e>v&V`{0yFx oIYVmᗑޓ{vf:U7:}yagyQm }j_'@{.p޼})$bbrk Acw9AdC(|%UJNμ_K®M3Զԋi:} Y)n1Ciܭ]Sn|则~:|| 124E\xgGͣHr V+t`Hͷe'H }̳pP6TbѠʂJk#5RZfN:D(%+!칒FuFhB4#6 fynJMT&&br[ 锝6cO0[?M*ZΛ w^3eѥ"VT?b7P0 14^N T Ng9݉"ΐBF(z۷?FڷeUYn a. 1`&H4D!6$ 老aLYq/Q 'JQ r1'$|FG }.:nnӏ׎{ֻ[N ,ˍU>%Ci+UbCuar ըy_V3g-Q+MuK*Ɓ )갃| 0gR02WdU2WWTUzYKJFyg#GxY]YWǴ\ZQCs&I<#cޓLY\Ftep7X^O0xFX,cٌ`s"DnI\EMERC-0R" )T5(\UiImH; $ YVkת-u+Qev U׵jZkRx{hkenf#:7O_}m*iLD !d1c'P~A/|4y棉KGuA *+1 :G^4]Ա_<(eEO}v:#Hg~s~wOXv;od?UTvΪvK޼~ c/ж|>$Iy|`=|ޡkj`:ix&j"..gf֦ԣ&`ft12ۚuWNp->]͸yMrF9hq2I/N:e"ń)ӺU tQ 1[2͌$驜Kরlo9PD#U#DE:$44Ӹ/,`qҨ| d%i߽zKnt9ӌdLI| `ЈzPXZg @u4UC^ oN5@+9giUih)+qnHrh`(LXx(GC i+_H;=BEƖ Z"&[/2j-'VEzlUZ9Vh,09.\B% ( ^QjiO+Gbgir5Jx>V?G–!zNrJ`5ʤ14іn?zt@KJ{zˠ[LmqziOz$Zetm>A B/JPК$*1BgL\ȺRʄkڊۇ߾s|V?w_W LJ\Kډr C?.\ {!i_%;~Шp4O{Va([@2,r=7{!>r'n:8Սйhԭ`m _gdĠAf+>:]76㋨MCQ1g NG->5R+ pTIȜ]ϱ+'N?Z*>l9o{D{.ڢS]YAaWfFѠD=C Q3?[ϯnt Ѐ>S]ረF@EYq8d"esv{[79C1c$;DR}D KO?'UևGoKTsi`ԗǠEK&|8`ɺgqՀ:ҳE|uOťMGB`e* : n"9;M%bذl-#^eaטxm| ek-[eɖ%G͌44s|`lڇTUyH𒪤~Z&2eM?!e?qb$5Zk&UWsBUUjq5T5Q]uu-%NWe(h]m:Klu7=e^UL!\~lmkuM˹vnsr[Q'!H( 2b0D3_s.%)4ABj<}AT&`dB8=@2sr;|k]hF YTHq>D5ȋAT쀜z"J[7$ 7r:97tq<1 <>#D \46`?z??.EvZGc$G!d~5QM2磥G^Ƃ)iS#-O; qTQY]mu.B*< .tz}00cwbuJ> {G UJKRq1-Ҥ!X! --R>AjiʖFLĒ meLYO,t T fӱb)o7p6f\cApfQg& pu!RtqwZ+,M 3>b!183 BNa 2w_<_b(DD-ߏ05| gq!:CFR3[{sᅤO 1³,Oa3=A9̓ت2f\Z*+T`e# SKGHPAU ZnкHq---9`&GbRZʭV`&nEc6]5]k&Im,+7l\{K*X\+UPho Ib>[I|Aq훀/U fwС_z|!POQdcM *ϕsQ*B/QgS1{:qO&V”/s - ɍ"`:2laIc[ /G@u4H<. "doк@(Z:1A5!KRh˥J4\ R Ful78]hpԈA5bhGcA6\S~|ujjG>ޔi: Tl͑|c38YIRq cqçN_k32L9[bRy,4cqle(lM6i #1!\0K:'kO,/=& 9,G*+nH[EƄ[ۮWXrwŝ{{{Vbs@;b}+S{[/F:Jʗq˗H9{zm˨}7hˬ/a!]_/<]cWvs)3NӉ Mٟ7bryOdV)^*ƥodb?ROZ .[zy%k_7q!rr6N3WTO]}PYMsqcvzK뼯[خۆa^C-O.ΑKGGT$Jv~{Gj)6}6`J\EJEWab'=]xOj6=bVVJ9 ; %s%դPs Nw"qC<ɡS(4O Z$ r)_R>[@,GyV00"ӌ LG HgVPУ&q337ͫ\ ?=:d_6ǍÝNCIvguQ_ QRR6U쌛ÛJ'mmrZ`)SWm[V%""=^8r{y-h6< . zEX"qѣ@*׊e7 fpȃ!6N2L}60堲 ~m;ι.77(Q"6k*lg$e8#>䴓8&WO:}O'}m),޾.( ,̓$4$JQ| XYzd&& &q;%iC1r3=#N9"o#ñ,ig{@=FYLO?K^˺RIe}f %~6n$4Fn*cXhD5wC JGW,AՃ,hm^2?/4hޝ%Wh$dJ#3*eN_r=LCI*S6v{<ƞƞ7l=cc-0bAHBHhmInj""[@|u*Ü$R5Uzw^13 XPY J&5MJ! 1g+֦//[GZ[ oЕʊ[[m. a?9Nᮔ@ ʎg+Afs\^Db݅+v!(82s=mSL  ŅFi=g~H:IȘY̚ ڕmiEj<9HVŃAaOIn.yuM_U~M`W6$1Oa9nC)1&vJ;{ JEpN1:,W+lS&Ssޞ*Gih90-ቾDs`2:pbg[1ujk:0}jX]Xgi$m3q贈Fw#[#~qҿ"]ǟzsi"kӎ?o\ Y!Vswq/İyɎ T)mІ< )Ӽ%hdu_Zu M)l -jHC?9Z ?#lLS̀9|ӖXrdˏ`%(KcWLغ!F\11LPXÌjfB֘"tR~!lef*\$tRI`YüE^PHdNcJb$"ąwx.\nSN]R*NIrMj/[NV bMalU hh,HtoNW@hG "< D" L^1j#`Fnj4FJq1K1ڻp4Qu[D *7X`T-0y5|F󓳋oݭv:CYhIn B>p'Ä3\*KP {=dkH\: ÒqUGgVF"ۙR\}W<,A/у͕vvKQMwxb?lTa1tB kݦ ֞[z7}tYB ՑyisivC=[귚suγkힾF}e4RrSڦ%!Yg١) [NrN%Ȉ4g7*F]@~_]@sרX&-֛g'LOSsIIs!B$"_][nR6st6WVUQYo}꿀/([0A֟9,ONJ`_qRSampl=heW' k[쯚K/F8Z`.7ޞڸ }1/}$ivc'M% /`M &60 +BBB.]{޴v/y}i_z$7}3ߜ9{=>g!;>q켥#6z/*`˶c iIUy'VldsMϑk^`O4`=ϰC/(h9固" vtDrؿicӴ|QWzWAd.3ZdWQ峹L> uX1yӓ^Mne+:׉]\EǻK7f͝#ryML}'cо/%ɀJ#yLw߭H"]IP1n6{`Ϭ9j!Fϣf~S ցZպJ} { {o>EK>3nqe>+\ݜHQi3&HDr{݇ F ~-WԀ-uC?V;QKUs 6\p`뺜˕Ogd`6++BMՋo TxKSseU. )%I.wSҰzY,:\t5_Tz6[PTєtIJs8ЙR6&9`^'.sv&AVd˥\lane@4aB Ct&)HT6z,a*Ƭ/MW}a9%UdpX|='Gg ^SD jeӲqqq [;;jq}+Lq%CYtUž=B [HCU;;{;*hyb]V׷TR[^!j?{]f/$m CΩL3):&IL`$N;<瞑s6}K7C@CZm\ U#∴VX.UtR-35]9xUϻ}𥢳J;jAx }~jofV[ޯ96M켩8SּY^)p.e}\0jSUvMuvAN?|{r~nrssn͹ /v3MUxa\`[zg[_oIʿWh:vr t#_WlHi:T,LY$si!.60NA*r!ʤi N3l)b$p K1H&\n՟\>TO"d,U|4nz\r(h,$ VeZ;tF1aPI7٩>@cGntr<M@ 0D-jk{$U(d&C5&|P:\Mt_7VE6Ďi;l8.{#Z 8C Uk Ĭl-2¼3J6 0e|)$m҈e)*Fo9Sݽ-#W,#u6"q 1 t^V-p1 jmm'7slDr)O"&!C*2NrI3Z ǔј`nFPn9T3 eaxŦ?!^_`:\P70 |ҰPGwUaLx=0Pi_9QjP99 @0<`s})y^xTi; xƗ!@ר&qy4jGrhYᘑr.Iy['s&^I1v9bH1M~ft}xȲ,SRs 9fD:r"uəL>IO\矹="j At]p"X/DO՞*LQINo1MXӋ^uö~^Ẹ5p5K veG\k`_.QS*M-s2!Dd<wg>_hV,޳FN{-kw |@/0:',w,WXYd f?nl5MHńY94X PRWi,̭Ԑza\/$=_Lm |u5`c |>@IUXv2[ɓΞy(bzNuo|MT(`+i[EOBR⮠y/`G?Ĥw<j1p:~k/OV[c4-d((pxOŮ!$ښnj{U|5hf[rqtQ!4+H2iFBH##.B?XbXĖ'9/pH_Ǝcq8J4ti1.ċ>&w GOnYg/۪7^_/B9o<5|ugD(38H|IJX|^uqgQ.\ڭu?)}|j-H4 /8Z/^;dNE"lrkp S:rw3T&K)~ (#]75I$Y_|?-f A>ZyNMݣaԝ3ۙa1"Q!_tux`o=hUʟ;/i^.nXzsu'7>wUW/K_'U olur$on=/+G˯3*![] =^W\0Hgô4E !F(<ڠ( F+Ė?"p}\Oe\a9piE5l^BzݚցmpLJ!en^fWtVXvCCC@Fח}*>( aD}su6j-7;6=02*KnTX6SyFξH{7:)ۜ~, <cW F@h.^'4Gkڱ.4းd:x4[ d\_oTBwߚeuߛ%-=E+x.h^7_\q^7>r46i{k A$ 7IF#"G!WŒcaF!C3IqRM3 :ST.760qc$.ف7oǰa7ރzT fci `(3-Q3c r|(}Sv8S8ڇxGps%ltym-$m 4O~62m<DGf0jvE4. d <+AA MP:Rmo-5C^jSIJf%V5yby]}^Az6m U³T!]n"Oi~G|*wG~6oX]?R}KrzM!HեeتnjHnf^n>ҨFTIhiyb\,;Ru,MwzdtX|x Q#hp`|vBn5Xr!:B;tQ$F]ɏaäٝ~f;,v.L~SS3pjx?r,+bqfNQɡr圩y2y{v6Z^7zm}5W|ۡf}c\Dm=W{3o| =Z."u\ )o\'5o\7g {P0nV e뱱 }^6gҍ6]7r} Ț IBHEEZ`Dc=x9|3W Su>۸%LqJlkdc2*l2%6ES)R$X@$D XЈm؂łUd:\1&39h7o۝{X_<{ogekV{r Srx}<ʅ)hzLA?@}7Ƞk_Z ըfydt&SLdKlValwࣳ!{#9{Jj(Dtu؀9eK(]+eka˭;aKtOy#RE>d rb6UNB4/$`L(NwΟHXh>>ٳ4Ӝ_eK/GD}Zi6&=8\R˛,1}F$NF#,ϲ| jzK5֞ڰV׎Oz?{^ao7Jrg6d?2׼;{sr(N+HGMd NXge۩^~gEQoULuDD.tG1K;lVOB(- 2Ex"#!G qX 4GLi? {t6zȑnE[mǃK5OE4ȳ:fȬk-@bA6tOk=Ѯ lu+ߢ+"dBYJ+GYu[ٱFhkx+bǘ4fbpw\j}-:%N37 gNղ--X/Eö!A0.$hґseq͖J"Lp{sm N0ҋ\7{6u'YLIMszr3Յ=}wY7hۮY p`ou uiPsD"duX:XOh C@יt>ϱhѳгi\A?}XTp6! QӲr,chw1Fi N 9FvɎCyf_SDvhኒz|qx=5áP?◭;'~U;QyȦ}J£I*Gum>G?iQxǰh$2M;{k}Ǥw\"ȌwY$5܆+fU3 blΒx)T?YNVrWU۟Z]T!g6_n~Wޫe ǖG:tqX쟜8ZnvZc}PCK>d/uD~c۱=q:7vF ၠ7x(={ /TQ<EAA5E@ IH&de7  /j?ujvڙgy?L< (&ag puDTu(l$bzڷxqdl~Ydu!.[;XN<9y' Nf|+^5.%@Ab'!ƪc7-xthEM"~X oS֩vjrs×PyM%} TX1NkFأuy¹nFvҍϴcĂ9T6|mўPxؘ+Ʉc|}$XW[{ aXD7-_h|TD*&[Xmr՟5 ~sNJW GcmЙ]ͅZxQШi>WkG[Hr::|2VANFy6}X,F+7q/ˉJ} :^T{uBSg],Ec[xG V+h'q$ňeخG~D5cb..7_25½%?cx/5NgXFaY[cYCIb᧲|eip+U:nޮ*Œo2)QצRf2uNXT#n4OHMmO=ZRи"$B|Ij7Z' EEz,3$YE^bȒ[ߏ*\3&iF^.B +wkjRRR 8i>08Xՠlft$ 2/8l4I(Y'O=Q]9=K=qdoV*m??}$57=-'@֩O pd3r>ݗu2+73=оd9qPޔi2},vrNW]W܆>s˩3*f ' 1 fJ3v.UX{`<+uGBDĦ^:e~kZ Mrll\yYQ]Ws.&Zrz}$v ;$xIIHE{3>UH/3]&葶# g 5mY)n*7 &G[aLOKNH[U6U/NT>bU.V Z1t}pA)~_X{ 2yr;O{pݶV0%V;M9H%tːLqK:pu_&a)~vT{9f'`KtI%eVt74Q{v[M_mֈ(Z@bj 31CcXySEv1 tmmx1Wd~.+\eд"slβB, jZyW>VqP550-kjq&L\ ;\hVGQvTVkr$#aQzX-3h{%߰(Ѧ"&ֿpWi#0 R'ѱA4Xd\t,)VÖ2Dn5[06 SI9h<rq0:B/^I;BBviD;Bi ,5bSup׮N,m!jb6 Exk3̟F 9֧ML=T}2|AmĂEoǗ;gß}#K;I"&d6Bx&-ɿD!ehCDVLt5t [Ô-:w> CӨSN_MH'yEcmTѯ!c{;WzG7\j5OI ;qm{؎k:ImфC@3Oh-W ,eOz((Ih<4F1tBg9"N_zbG׆țP0Ј:0Rx X@PPtkK~-Hw|LH%!9v-iQ( Cx{J% ܿ$3Hihs.[cҀi2/Z Ǭ2 GL;OxT!bЯeICLaP8WFQ탨@œ&(ZO7U{!j(2|F`jN:ρ: X|>Νt oDP` f. Y( 휴6^( ;ΎP?yN|A΁w>;H1i:LΝ;ǻX2%8!d<#Q2d$ǹ,΂Se3@ $*΀3N586VȞiO&'-7 )Nbq&AadeE/ᅧ&׳rn9\KS T2JNX.ep[XÂrBlCy֙< 9>-p:J 9ρ-@)| Tj~/`\O=5Q׹o[kZVQZ0!/9 IH>RQ<oI;Ø4/8Fd/>kT|vnGB% [^.WLp~x[,˻ Ʉ3+4\!c8ai2Y BA =! >x_J2u ZR$^rXwEJv_HwQ@8J!\NG듟N>}j6[L&V5?|~ԣ9d<^Vfd1ju- #wjz~n}`F=ߔH;M[F4,Fֆn}^%22zI$*6o~lOEߺlT}efH/Eo~zṗ&?tooKS@ڠiѦMݦ>T)ȑb˶|!ɲÒuI:HRxs˽{./ɒ"ۈQ ڢyj 4pp7ŗG M>{2esmIÎ }iJ;~%ȈdQ]ËEX+ E h/Ҫf1: (6 ᝎ'F6>T J8MN.$)u5W] HJ/gH)P\J!$2H9p@d9f|D$)bƓQ\iĝWKD_5጗L` (b@#Xh?)س'dIeR<:uE:u~͏aw_j{G7QHhηmot3wC׷jVS#@;S恤w3>7$I.$م %\QbN1LkTHG/N8~5\C><i:jx.kBhXVv'VK%vۺ\(u'bg;C2[wqG&`3Q/ˇ!B\sTǧ[wu[0WG\o,[$S%!b1phPjH&h8,7pM1YRgNE`j]njK }24?-w&ק+^]G~}RY .{Jxid@qh}<{&VtχKReEKEVF-Z|9Vr\-=<h¦ꑉ;Sj?0#Z+ 9Oo[L6cs!ogO.?O'Z?|ѾyܜDfمh-.1|xHɲՋreJb zՏ]]^r\de</ K7CC;x%G0:"62*ZKrBXyؐ t`f'M7"q[3dɹpWm3CɌqjJ߸}dcE^%'ed%4#KJF|DB8-vv%A*Q(1MxL4#llLo3; }0 ^ëL?5M@'ISDÒo49p~՛^'b9/%o=3Kjj檱ZsXݪA?i@uPT~} *SJ'7bx%bRlooޥ r :8i j(o ;i$YTb EɃz"6ʅ1Ǭ@Z dpXטN(0%qbÀow3ӾELUzelVPe*iۨ)U:McK(o`RZUWUBk#k@ΪV9Ot;U4 m@k`*y@W?0τibHӵo]}gޜ76v/K6Ne;m&nv͝NviÒa%c dIeٲ%ٲdɶ,;Ƙom_ڷ[w7gΜ4fl(M{"C)Ϡ px !x Z;X~\GOw:x6&H2S rBW ƦX6t h]GI+(!(MAIbk\jZ**wKjtv:^Rwi Wۯ]~;5zӵ}pXqPÃ*~[LǏ;vL/w~̔C{*{hFWޫUsF0JN"S,+W* (LMe97tzsycK@ & ytu]'l3N#GwwN3W\]͗.+gگ[kuByL)ef'e:Z=M^X8ih?@y^1_ J$%<fxY)}(h-ZKb\i-=p'^u 0K|>/A'.K%Ʉ(qQ狉)IL^ Liѿ N`q:Y F|,G.YB#[ӏݰBs! s$h p _yaLlj+7oIfY2aQcwݫŰ`mZ7e`3絫iX-*XR$X Մ晰~8Ћ[&)M`;lRHB5 \_50/2ZEJ=KR§MW$1ipG/Q3&0iIE1sIQJ)0")9Loщ(l6@ @h>#E'+߻ =2#Čf [IZ~ `c0x#l:aUpsorm!:ܜS~C 1Af;nώqO~KCntc8a}Idd$<-E>=91(y u2t. 2#0tM[`:Ԍnoc+砙+޹˞iO!K XEwNG'1Zz3,(iM[ }0~Sde HPo0bdf|g 8o}$U[zx{A3x K0UZsaӽ˲v=j 1dC1&o>GSFCGkQ[켮?)@/&cW'tU˯ |o`"=^wv;Uu!zoo޼cC$m  Qt>!I~<:J)F*Q`#Z欍? F,Z^r.DJ5KTҬNԓ%eXc9H50Kw4#h'jp0t+ L53g`(\ 3_\% m;fzYj3ISkw Ǝ}zU?](B+찄B̺[dw;ւzaT$1ed"eSl:M%9]0uTK,n :d\6#v7ڼ9]@$%:=/8]wGc"WǾ ZZ/)2p՝{osܚoEF6?==Cq/Idw;Ѵ)A[c~<gfY>2?O N֟4˂~M&.ʔCh`q-ނ&KQ5_jbi9}v9MFle.:8yȫ'EnG8t2y=9ϺO7 ^j'I't af\qMi#u8ocM'g!G [DSul4 d4)13HSȒ]ԣ${ѥ͡jl*qċjcflԦ3d0"A:h?:֧sOiD2 !mN;hxyW>&щ!t7r8ٶLA3KyOZT~ٍ|>c6θ>yC9jlWLDK3:!RO[=% 6I†p Fw7\(5KmڌϚIgE4JT0x 7LbU}`Wr1%mV=rER"YqÙdM1Xb'eT ťS*LL=#7%*:CE'r {4ز0hnW&Hy>5Com@L{]A7628K3$v? ȟaF`|j.⻽ԞUoh8 ?@{zIܸ J84>èCysCq\kF&f}} =1uE&?3SBދtU~p0+iBg{NVzp ϩxGq%3hxt{ͮ(7c*䓄O_xƚLb]aCJPz]oᲩ^ԋp#t,$}L8)D6 X;15t|`̸Uu-mdf97ˆ/7MU۶ +_ h$E%HtHI9[M:q$8k;>%˗KÖuZ%(:I˶V`,?Q/VϋDi]'~!8|3w(8|1 D!- ikLpit6̦eUJ JS$pxt$TOG>Ϥy4Ic&J`4@j.`J8 Kv澀c2%{ps,kbǨ\> EX[n޽ǯ/6(0 L8̿[Kcgl A*^ )gq "iئ!sZ{an3K10f%$}~"i- L<DlqUQAl쾼A,˥T,` s:˥gΞ=t'pfJ4Zr ݓT=L>ۈ |~͍Vx7.eK|ȧ0^"gppz eF0{=|7mr$ 7fG9*!h2ɂ喉Dyւs{ہ\foR è{.)$|N8U I,mܺ l #0N,5ڊ!y 7Kq1c4 $la 4bs~d㓢 7i(КN큙\ xH&gaÃKB@̦"٘vXqqM}uxұtC[vƒ{+H?OK^x120=Cl8}Pӫ<<4icGrL\Ȗs2g|%RQ Օ2u)mw*Ri;_U++ QWk;J]hij_v5Z ZpKܠW5J`0HTׅrBB.ѷu;;` tQ>jBM 3o7F~}ݨ#u ͋zṕmظ n*Q0fyoSEғ+bD2J3J#C.#x}h= =h[M?Xnzb+|Eю_9k)z.1H%Ɇ<6t%첐SHd=b kξ֑sW!xtpE7^>,3"~SOImGs*IUO~)iuw_HpҸ5fR$Nck޾f׬s&)*}nC$XNh/4}޺mRVjT+jJgeNFѨԫ+ P*bE Q<}(>}i>9۞m>Hϥ.ddyqB<)M)d]m7&;O߹鑛Fݜ\ZZN,+i|I9/]j:;Y^$$HtM$ǁ#fIP8H,HG|"Z&`#@Q/7N=m6MrUDi uP&(寖\1(|^/, 6a\{$\sҘϯ=t1Nƹ n$ԃP%T0]k.%h(!F>5<:$ο>ku4oΉ7{S۹J+棅jR'*3b7_%_>~reSWl.QN-\g|ũD~ Dg)7h`~Үm9{c98qc]Cyϯk,!2xקDw!W'3dVnZ#_kY06~;U`D'N߶3Amֵ֮fY0,bȒmĹ4s؎mَ!߇$KoI %"%x"%KC3`>tt/[/xAR">SmVֿ>~e1YyÆ֩ENF=<(h"+]ѕ_36"4j|յCBg}為븡6PD<#cY0"j 2j ]U942Y}D 7{?2]IzAO ?MD=qv=}W]g279P E2jeM(Gb:tOh`i&W R]9W (ԀV!&=%ysӵy t9hw#PC(v1D;'h9x5:`hYFE`liv~=ួS^>ub)Lj x.x$: jl ">; "szbC+-Su&g'Ⰻ%&4Q03q ҉l2ƥ|ȓsӺ@D֚ %nS(DVuxhMK7u8M\?0%m7l%t̗8h>8騱;kFt:ك9l)1B,dx)E.U,0ܫ2urMSlS,(cabj~r@#6 ^ hK +uK%Y݀CE@ڒaPi}mʲk7di+V,( QŞ/B .(LIofXmx :#IyA7%>tʽɷXbȧnc@h"1|$l%zR,_Ъ/,u>\̯#br:PI7BL(KC>t+`Wej0riMlbB뭊L-;;ӻ[权ʶq2N479r̙6u{sSX Π(z_) s &Q9->~9XPX Vq;*D!䖼f1˭slQ%1"I,:x %;[kɾ SO(%–^qpS׎:\D8n~'ʓ c'G-86Œ/rn3)Wz, %)S oUPк@ <SK9aP`e@bPN X%e<gUڱG>=O%8FUX*x&棝mm_YZ.Yϑ`W "Ϫ pHelAiyZ4O.B/nXay )Ƭu5֭9gaa [Hy]w + a#Xoh ?ipm/#lbbVәQ }xp2C\}  LNs5ԛ :Rb.SV[/=:'I6Y 7jNlk5T;&{ݍ? F*hdsCEZ;?{@$R$T4ϐ|Й}4s$8 l3e@kfiZ`,Ë)KDGl = F_.9 :t0JlmnG׭A\1H@Sm 5{-&Cc`[smR#'`UcKm?aB'O&T7msĤ }{~ea`3Cw盼[Q-Ԥ=݄no#|{FV ("ʴ['+DV5GM~CS4š)evh%m|UQh1xrLiD(]~.jxEnV~nT ;;IM#p^| @L\ ֛ռr 1bHOʣmŇCϮ": , o$|*5>k 1Dr VĜLן ]MPm6ca!4]q~IH$v3__k&IT}5ByivD-&MII CX#\dL,O@ݬ2r'!545sˆX!<::7WFFY~DQckQ;q -67zo.[Sl0Zq%$y?N1` dxs)98Lox%]!|*slylg6w3TlY,:-2I`霜S:ȉ)CQ43z7~xE~T&0hRe h O\B$A:2d Be!HgA3": Z$z!dM/;}iܬ abĻL^0^A.hopHǐ~.)Ǣ )2NщţAL* 8t -4eҩd"~i!!l';b4)8 LgX7Gm53^TT)p9!3I 󶞝hZ0gW(4&$e9i$X>#sY@̱xt3*db%D^M֧AEIdOmX]/t1/ꎩ;>=޴ zpFWLH tBvjŏ'^4O|.VȌK Tl/דO+ε\f#N岀֎Eh)a9Ƈwˤ # xxղָh旅c蛠KP;fy]ndnD!a^%$㷌#ФrNx]q&̰Iڝndɡ(ڔߙ'zUҫÏ6?tΏŽEk&g_y/mLaj :B7n~ѽʆ->[Y@#ku;;8|ž9JH`8|r{wp#ligQJ$E.!$KBlu-T{䊽画64 :m"'ԇ"ѧڭj  ZD(A BR ! I Cn'rb;cx|{9<9>j}wx~i~53|*= (3kw;p ~r~xV}bIu y^n}qeya O AhO$yC}ѣǬa@v(h i>/ Ih*el"Q .ɦP:g"x<8[\v7ZXuBuK'z {#D0ֶ{VZ6%ܻ4Є), \n<݆>XhI.DzovM 1Y'1Q+* V;m Z¶K|!%@۹,*sUM{xC(VV^( ]ѝ:NUCl*ast lMq0nv[Z7Op~;YY7n/~6AIs_([{ʝʿkN6U:D՞:Rq5~ yYr/x8 ry~v.f(Ӿہ&)wP(wJQQ"Afbp@a3W|SؖO@B˷Ӗ?[/w\s(0 IF 6bt w-Vx=/VyF8=[dKN b6E*»љF1r_`xVZK] {A9tGw\NT/;v̩BTPrjrr[}.s!#<t9UݳU {EV2))HP888uA̬Ƞf#x2$⨕yFu#T"%?jVGMKFYkKP`kUOSM4xt%fYYc^غ1> qp7Ǎ(b鵑n[UWt.^`D\N4qn0G)}TY s*8Ӊi;TФ &BT?%ms?WYua RsVZ]. i^B ϢȋiAT]|FQr)5șOKr=( Rԝ}m%f(pҡC_`JIJia`A|3/QJFI|4c.VonB(t{FH8yAbEMڴArL3Ic? :OaaQrfxdp%D2X^E`<@kW+!fx,3"dYTier FҾ|]Ѝ|D×]()cs.E99Ygu{b(TɋĤ򢴑6KoR:/)cR|mo`ln 3#Dcm% ݂}.wջ2odTf{.Evw ;>wiȺRߜ*+%9Ե<]Z_gP4d- Z235{H`{W#4̥0 W<ˡ4G"pj܁^$֛.ōyɌ{:Q8twڭTuݍ$MM dC ! $\-w3mƞ ϕڇUo=cR>- g^e$%sE_'_i'ys!2[ ٴa'J 2bUѺ5L"e,lchA?CH "6ìu݂lMn+f1s0lL,@#Nڮ%G,q\rzReSب{vw2jgrG +qZP%MΙoZubH<-.?^WASZ3yj0f|9|.ǃp6@6RRv]n݅9|].}'\F?4s4nY})dc2N/%OL>X3背ϼnffܯ /w,9B❽~ja5#we䶒y\{iZ%IK4u-Y8r3/c޹/3jSP~up 6<@u|?|R! $QO/Qv6ŃӈC*%8IpvG~|K$eRPBU~:jAŜ߭&44HXK)$>/bֵe7/GL2ղ!dåtR|;k[4,9: _@,L^3!~߾<+dĞ4_򢥳Exp$;WE-ނ`NcHⱴK8EBftculrh>ˑ`2pUb} 7ԫ)=Sl~odV,M8GcZ @)fQ%xʗ"ˈKFh'ÎKPUC~pp]nicgyes;ni'9yH$hg1iO4o2';&ƷalGB`ENil 2[=3$z 6$ ]V7`B3c8ssӯz[?[Y{bxr~!#f3}ǟtɰ|9'rFi}R9-{bH p#ҵ#ufꮮz j"K8Vmվ5ˬ5[֮hXܼ(hB @@%$K'ҝtIBnE|}ڗ}SSλ;eK傊r-@ܞ˵5$w~we`\2ĩī{?kMow?ԗwGXoG"Sͭ6gL.Z&yn Òp`S:bX*1\.&&!bFZ >8nhb~MI.Bݮ/_.L%Z$9:wɥ'mH)/'CD)^0$e2.tI/Z*ho|֩O|~̖]vLbP:zJ'%=;1Aa<շV8^-q*a9?B\M]Qhh2XׇúN M5p"\fē3pˉE\8 EG %W#SBBWrҬ'sE@!^f\{so޷]kH%g5ySN㧒C=vdfe7-ͧypOeBt8RBOgr)ִbuPY˳iT_Yj{gL}Wyd~$ƭ ;{Nsd'>lMޙ`"ht|4=44Gؔ"hL$3X%Ot<3iOq>+ih&GL(raʏ{ _"NTɂ >u~4lwC _x&ɬX:̉rI@TN R٢vCB=:홭E'nb!{@7,K%:G,4Ffy3{oğw˿w3>BB|xjl܏(,zw҅X*ʉk+ZXQN͚W"c!ɉsy0A|l0m<(*ݧp-R[UG42S?zthC+|JX]Q.iC. FR`n)n:JלyF)qb=gCA KD;w#&- -)zgSءae4 7CmϠ$#>NL;:hoմMآc<.z^2w[}\Qa;Ejzdْ(|" E7^*r,">[8A ]/XaTa ?[΃!9pH a($SP6.("f2tZE<'9637k?3F`9q+@χ2- h<ڠ7*!ʩ,JbY?=iT US01sʀ犣%z߶3 .R+k7+.I3$q8Iw8v|$R|ߗ[mݲ$"u(Q)JmK>'VÆaؾb GCD>+^a0cB0Fh4cpƸGwJԪ1cBDs5|WG0>G'X=@18?wЍ7!dIbiԒ/깷/Asĭ7>,U_݅fK3%VX]4[.vE|v< ubbJ8i$Ovz?Es9d9WgxZd/st ?==k{9TW@·<\S88s|ĸT,sZ4?N&5|M ys f~:8grbrOos5|1o78sI A aM\)KA)Xy=rf"tl/ML|!wHT:ͯ{`{ߡ̓δO:ˎk50R>'W&Rp 6D(&v;$P66D?,o}".>=U}Vm~֙Å-s-D X݃ ^7!Bc[a7bBòшfZש L>/ { tƫKÏ&DWņa :d4J EձL(ĹQڋ0S.'XYYh.'~LyYb1L5cmhSUPκMKcB5G" _]/nhG% Q)lR\fVki_B+Cx _ԩSuF0'RXDːސ Le[brǘQZnSh5 !megƵ>y Ob# : hɖnMf[{iX_rRPQY3d[ڍSvTҋ.*o~Ww_-TߑOTU9.27*Z:NB  SKh12f;&M4=HwYOJ楏Eq`m#|ֱRcx;u6r&`lr{أa̗5tE5] ;ǹǹ\^@*uJAꟓw2 ѺAURMC v?tiPo2o1+$fsl]7GF\ݕ"* *hdKFFa깻鹙%Cʷnt+zU3=LT7h}0O=t:H@D"&&hxp4 4P^= . %9g 6 v,\\SoǓ`&F8WEٌ S=22}t|oGrEdK|±yc ҕw=x x"9svaG|,"_&X\Lω~!,(b&҇&-gkd}ӬyUKCCw|h침hHz.҈fPJK2d8bqc, e0v0ZrR3Dq\,Z@ˠ fàNގ+ `B<$@v_'$ݧeb֒>[lpofAa-@uG8#?rLwj,y:z\׫'U^5]&7f&1 /[d6J@I5u6UWJLItq+Wo )J[u:#yQ;kZ ..Z B F;`i֥WwʂIf߾}>:˼A-(W"l.PMvAZ~zϠݫ)xWV7mY?sw|ԫb42`+hE_;V,t1Y(mrܖM}oqyp1_e(Kp['×>_k~1rb myO2rSe d:KG$6H6nrj·>\88[kɅ_Νo?]Mn|3N!یzǀ \b'*w5H EBl$ eDA ;ױb\:G.i.Tl0mSufmV@[[J1yM7arZgy1M`‡C>_`h8Jh *-m3TTC NyAڭ'*g:>+YvUj6 2jo<6sݾڋ7i󚧯ZvRBfvsl(#@k~|u h.$Sґ(XT2BzXmlhj{`QƩ}TԤl.n5w_7_9gݜ-/uzW3哨sŃirlx o} \~ѭ{#+AvߨPi\Kؓ[Pòۛ5J/!pGtEHKWuHi(]/0: E 3T 섃8$ uXTƄ6h_9qj?PvcȆϹS~~4ܨP >HTeX4Yޱ4/X\FQK%6fZK~{N߫׎5OL=7U^}$`ad֐NFݱ+FQ%n7_PX,n,g(f$m #u&ea2&F s~3Zxu"hnuE6u8N |)[(edζl:lW~*g{`~ƦYv8Tu|P!O&R!- 1\aޔa:PclPbX7zy(#Y0F MY+qnyTt{6t8F4/Bi]"VD'"h2ʰ07/zf]oidg7Ҷj*EJfMݤM&q.d7{:cw_b|%6܇afcml+5SόS/93g ߟb`wpƴHq5DSa,21_lS eDxA[ .=j+8[^\wpFh\@17%$nrȓqoy&n"qWHy w. ȪVx{5V`l+T.zQ:݂Nv9JBTEN.%c$' ˏ;fXQL0 jfK"c I$]xu5tbQ 7)8 Yƒ[ @[,, 76̮$`̔ 1űB>_:dnA=6'_83F'X3g?\8 ԲX-&{_QH$ЄFyU!T\y4n̍(H9 .HM,fۼEI>(CG+Խi1@X!o8LD(c1OQP[c@I Pà:xhK"ee"3 bUuIzTWNyj_VLy|iyy]F(I ͷ%W>87t{;M(2ڲl(8Mފ(#N&@VYl:M`au tImoe;͂qf/e4"0{i\`oan瀍}0upep:wdլ>0vU~snQW"+K 1b?l) zg5ndY?0f0?d~h`zd0m$ ཭}dv6;3lON|94&z7_仯|(rbg%w*UKx6MEv^=5rpG)"MmE+oɦtԙ"(4!C:%+?'l:Hul+)s;5YfB0ߢךvc%} 4IQ]YNҪ4+Jb]7(Up7j)1B8oh9AJ@ׄPqi  ,*߂.imUeX켦*˞vF%>nKSmuVFؗהU鹽?~jU Gb@ԉ8ciekf MzĜaH p,9b}GE㗫%Zn8Xa7ƸV Q"W/*JXiRkCRyf YMS AӁc*z7cy@(Еn'F+gK oKSӴ/P=.Pfg5p2^uNO3B3'D"+F@3E~y$Mt'B8|6n6ik]~ЈYZq:5Vdep*g1T3bxz˪쁻j^?*X|1ب9l~OϞQxUכR[rW3*i׋j)^o*U\o)/l(j4~N5;~OV+GyOs*Eշx}͏EBNO,!l^ʂտ90x.qk\q-l +.`:%9;FZ(tpNB+\._-^asb:!`?ts v4Sh7fJ 0R`+Ȳ%| 6 ,[XeXYVd+VOLIfKh[ɝwvJo0Dpr C:"IQpA=pJF9l<5 cu7 UFnQTbb=;Q A}RU lᄄ$} d)Ţ'5X$ qy)?KL˕ƇKnMiƼ_k{)Jٳpυ֫K1H5As=v?oO]Ӻ% dFq@z<`,J%:hqJ$+dXO?̜&dfO`L8Gn8 +\L\=W>+Oj ۓ|ʭ6 .۵ʶOXZ<÷5C9Ԙ^)ԲsSʓ2IiёϗۿWT-BCnNiZ`'=,fm28FÔ"`ETEl XC!hԲ8 5C4UMNT P{}Hݸm],=S;xfؒ9 ZE" 6ZbDH88531䌴u:'$kVTPRDPt8c挮T/XZ"@])Z&C(Q)!)8s/?~|nA@; k23%`L 3>G=a5cDOKug_K볽ү@ʮ tT9IS`ϩA|SGhх~ij(z Ĉp(Ø7{(᚜3oFL#FIR?Y2v"K# P4 D0 *$ !HG{c_r~g}uc}e+eEl9SqzJNϽFn=6DӢ?]U: ]ŋ6nЄH"%Sh[SH2@lbx@:xJlPNnSFz;٠b{# S;W- j͍-[]mW{[{@6\ P DM{[3~f_$cю8j 0=EJ(gl)཯7ƀ(6Ee`{/,3~M.;TS7Ѩvvqw2E_Io:[Ae|' F!v9D{T+" ޠJHфSk:=s3gȇgUhULOl@̛vI$0Gw>qȝc;GxlߊO?GH2a]j4^QiYuO` Sa`-\ o¡[=|mވ"Ugt%}k-?.=Ќ0adn2?5 .eT*te_j48mZq:`W`+p x dAK̯Yj.3[gtI:<63\PDtXmdٍ)@9T#Z 뒤F~{G{]ޜ`冩J12#56MFjpq;Q Ij 9S,PV5k-W䍷ڗήVsG \sQ(_6 ڐyAfPsnߔ$}҈?h\1h^DJۍ.da:~rs/tG`]~6="leflqTN V 4=l璬[ _ء fәJ:d3 4fmY]3~|'>>=MR:$潂I]qcq)ӷ\7AS}Im-0HCwŴqkҗVJjR[iH&٥$4&!aC@hI $\-p՘ 6؞m|_fW VZ/=gC̙9 r}d5RMʛ92Ͼ3h4F؅R} >Z~JTi}ⶮ׆ u:B#yhOTl'އmwVPDCY6g(3?4SnLvχnSLs6[xj/lSuߡ C9;>Glaȿy^}5yF*jv&]/'!Ysu fRt:+Zݼ |K%ڄw,rkΛx{vwRrBਦHo{hZiSMW: $~Np DI'oS$+C,GceShn;yݳq)\s\,7Dۈ!ak;a}=L/,A:l<-,x>"%I:%º@xHe1U-"Ç% 2eH|x0d'TF9bQǘh3ɵڍV!vTvmq[Qu'Fܒ.2Kz i3Hкؿ6CuRCEíʯΨ+O**-vW7_nMm5(Dasjcpqa~di"dm :ܢAJc!V¥7V9>WM|M 9z6Tݽ-*[5Y!YLS:6CH  |Hд :6u“iX 4j: T4~ gm9ipr*` L;._YO\]X \Kr2O\bS.cH/Ĝan6%q/ZG!gXLxڜ74AiQKBMb9ABW o jvdį,lH[K'd1ZXɯt[- ۽@"dfŤ\pU 3:f†F-"@,Fmn55 }b˂.N9 vRsYοgY.v Gk/㭆KMZ#bE9Ѻ6ZD VIqs]5tGjr tc0ȸu}uSzV|I.t%nAJ;?T{^ӍkGk%ܰ/+,6^U˪2{?#x; 59h̀@5g sX0 (èMCB͐d|e]s^VPvEP,Z+@W]U [mVL^ Ϻ7"#?`7c^…CkӞjSݹ%}RwԢZWΡ[_ʭՊ@oiz˕K=õ7sqlo׋P,; 48Mc@"}!qi }-i55h_5I/ZReK?bXh׍6f _0I]wTfD7,'a/ T]'Mdg/TJ.I Tf! a 03€-Ƌld[ekkI-/-uZ7Kr!rZNUI_{ԭn{ k?/~q39!NfR+bjrsNe rΦ`HUp cYc+:Dcb)\WYRűrb٬ zfm=­쑹BYяڵkbh:[+eV!"ohk"NI)u/T)ǩtb%\6Y&zt~i஽2P樓bT%ƭLx9ͥH!2TfxvA')Y?!g";dRww9nvٞzx2'D׸ZͿiV(ݡy1%Ýeѧ .o Z+3_~̀c{KSѕ3Wwm8Umc!ibHS|xNz}Zmo-r\\3F?0NEآyU=xc@~֣Z{}KBw`Z)IMG/#Ze' K,S/eOzL8!Ga>jvN'(+oE" 7KjY| ,u<×oZ6v4pHj%{uKЗMףcb1` IEQC?OA$8fIOp4@7S ~Ay8AC^Dj.cW痦>s3SKNIɪ;NE߂M2Bq6'w^6cVOpI]s^ mWi7Vx ڡ &^ͮG:yZ{4{bi:(}'vӂד?ime>BPXm&4}8Izܺ)41O݉<%ε>0v=ܻa j` /@$ФƫAr)6SH/ΈNm9Wl,C!=#ggWfYAHթϧ}hb9Q"8¦.NBЗB@$uqN0I!@;Y_2@"<X69:EK06A>o:쓭αVs)L`Qyb*AÔ)š)Z=t 6s}f/Dłfԣx؃2D /B2d0׈?fw$5 lN/e6 B̰uG gk. @F9?Uts #SWAdwtwaۋɪs#-_QVbgexp5MY rY_C!PP Ԭ,:t ^!K/e_ըh V B뵵MZ y}l0sasqZ 4~NWqr{#$.y  u`Ԃmkd Rw\bKڎ̷`XM ݂ QC .lgF]PBP|mjy'zJLb1< Ah6n3 󰏉pvム`1l1-'D҇3x.fWq>!t߾:kIbv8ek\?~+mҹ&#0mшZ[jǐ+ZGL4=zcƘ+ar]ssxG*ƻ Ko[qOF6Qq|ֱ뗚\vM;$1;uLTcI6O^$gh_[EtI7Y/N/VZ/\wLӚ&-Cե Mv8{.Tm?X|ch8|]޽zut-ʴr]82"xC>`BhR8#\uڒRNꛯ$Niҵ_-in2#'p%)YΒmGӾFeti)T4nG~ԃVꤶT?)=:,E*_<V{r^󚒜V4Nb۸|qz)ZhM( vlDچy#UٲX%[dm$)>38$gE%v=vўrh7?gp{M#ƣTuݱŮj}kյ{g'-W2oD$b4(Njc )7?Do0lezzVlN5[ڭi;D?x47dX"9P!ٳǍae244손Zy:؂E4ɇX>-MË*\ZhjǒBTpcbW <S=xB?Rei>md|Qn+BywZwȟ*#-mooJf&lP qU̜[e:EtIڮ]?w1 "|4O٘5FQ(m->G^=]_S鼵% &|rrMNNZԲ-Zζ JErGBxZ) E?=n9%Hfԟ!zފ:aUZVZ/"-nj^@68ed]Y*I}s%d튬5n5Mnmcfs,|Ǘ,zwiSYxpdDBXY.\uasG7״4}jmxI  px<%d+A|JeZD_hY)!Dk0eW[㊎E8dǐڏ ;^Z[nySswqs;rӵx8ei7_6, `#NL31}e6 tەTZZmn*kEG.vi<Eu +ECOĿÇOP ZN̋8 I!"YlH)0- ,-:EE8Kl9 [6J9ɚ#naP<[6A`+<. $g;SaEra/Y( NQ)dARw:% 8u2d {t0hGӏ]/0x>gc~F8Ͱâj #a;IxqrxJFBڂ8 %(2H& %M8`(:F1X&BBLc)&efsou"EiC|`q6.CO* 7|\t5kFό~/kq2gWted7~Ϟ\e{>exZ,g|N/./Bhj΋G4_ @PF>Sg@E\]K~lI@:]ʃ%cK"wKE1@o6w)v&wA>UTDRIW`f-L[ok2-D-ڐ+Ջ4kjiho]2;"waӳ-~+tJ-aTB)ǢӽwѯN5UV~aR7l:( !~7/|0}q.j G)9Ls:ʤ BUu=lClhfzn뱫봎1W(LIJ8E8B0WCdF|~SԴZ_ _4-iZuxSʮ*XY9).̠n{wA1NX;'6?B!SS$ hJ((g~bMVeh?i<;k8m?kweZ@ᙻWft*nLSwhQ`mNo__~1R 3{W`X s&~ *cf{tܠjG&dOG[ZYu?ާI3NS׍/ĦNKqb `q$A@!n~Eˮ]Jڛn LSisVf曝|:;^3<#^m"fIJ#GΛrvN/$,*1W,rEik0?y7w_|_w_ ]Nj~<7~ע[J<\ԝu ꧡ5zQ FF[}>su?:8<&Z.um3)G]n7&ZL0`Q?HaoM'XfDkTlɓ\7@rкNslN3xK{iϓ Pί½ourE:fb0R'& 9|Ye8:rdQ];ϛ.Z0;%ixsf>V(3[|qs7?{ Rޕreot]LHPֹL\=d}xp4ыDB8jB hgH]:Zl?V`v63-'{aFlb*vkf9=v/S32MACEǚHTZf)M_dTUΕXEsj;{NۭuÄc%W%޳CxW &߹V5Ĵ1d° YSfg/q! f 852HE/'kCWawᄧ/]LI$< i!a x'!qM|Vbv:蚖Ę-mzYzPc{:ꐕB 4NJAڬ$^!BDh`>P6-[4ӥCˤ9RGyůЯS6&ڻљ`.~#I@Pϐ Yڀ(J҆sj@|0- ev(MHrƞh)Wǻ^Ub_d>8[ﳋ>@3:KKC1W74Ṿ(WƆ6ny>HQIf@P$0$ ԡfOGxi"̢) <8'3W$)z!q!XبwM/"G}x>td]tz$ų|/tα@@BCy1ݚd,4t|Q,-n^Z"K!j=7+zVGisB;ϲEm HXL&á UWgձ+TŸ˺d?L}lb`Ijiz. :znL!LOARK 7% SшvRH}r(5ɒ+ze2\܃8<:W+`0 q p4(3;T=\[#~4)S6DtKZ0d$x%,(nmnbpW̔q<>YŴQ 3^wqn)X~PΑĔ\/ ΕqbQJU'k M5?2wEV6vYbЕ9*Ϋ͡ m\_!JEMߨ@QQֶԜ:Q g[ѹuotű?S1g:z]KzSOGQfm'cDJrFy6=5~:¦:b/ӝq&m֋.)@e@قl(:K  qJE<\ծ fBa@BS..<ٜ͊"ySDPB)Va_ZuL *m`]]QQIgEր>m_lDNcNXڢd%0 +ȬjfFe*yYuy%|pId |؂4я0."xi\ &26,8w ]C}҇.NԻg>EØ3)l%_!qsװGǐBfb$hٻ0G{T߆$/rƐq2X0G-Mi9n ,'(QHe$(/f\\ q,,a1~~ڂyBO6ARlҟw,tDĜY8$jID9!t:at-wѬy21y.,8-$\ʐ$ >'1k/X1p5s,5t #i3<Ƿ~ŜT4B#D M}l;;Gq_lke3+C1W̄qb "+qEEh-@E\׋rRT**A`2F^.@]Y@WoBZolV6 ]] Z&Vezj…ַz&3wwUsXa@hg8 Fw7qa "p @m[68bywwO* GB<݂f{jijk˹7|j1m=g۠"K4YFdj.2Se\*JL,gp()cH"D`${8㡸FbLyĤ>;>&5U_Q._'=c^֊_zM_.WۇL1:x<m9|>o pIKQ'1-`pI 鮷63q݇vIN3}ԙ\_&b@ĘM #M肄$t i%+ia!/tÆ#G~Z#/p;G9Zij1ܐ۳uσc5FVwqm ߨ={rrz|_yF{\VN,הT}'VXW!#LR_`#%)M"q*Od1:/T.){Tn]mwNac֯:=|C;dz6 )Aie95T?_vR ;P|6ɺ\ɸl_e9x婯:v7U7}_i[Q9'mt@)bÍGkڧᥡf(3DӍ~#I|b<:i䜼^KNZcOo9[>X,uj0iHsbEI?\ʺ}%bokzX}S]u6y`L7IDX4&=C ܼqH ᇞp5I,F6C?YIxN#{ekT2fYp;T'7L}ɽ:P dK. ŒfAˈ C5#VxYCP*99ˊ96͉cFޒ`yt ĉ|KO,6ÊJ! /@ϚDpF- x4@9E{>#QdK\@4{LfJ{e y6#r/i\t8}|Hd{xնR^K̡:4n#53A_5T,a2MOQQƢ&Fx@9BFjn^+B.eX7uyX" I:M,; aC4M4$Qm4cc ; NE], KA je91КG_?͕NS "`$CX$IxU,Mp4&)0if2K# $S3#kКZof|B+lemZ2;[vRg{{]uq}U}/b+E]w ZӅ((feے6=e("?CIt~WH$g|+z1X\)=1Aiq1h}A 3J|n8;8(7fC_Wt=zT:1 I9j6nQ$䃱@&Ì^V`.\)6T!ҖtwbYi7p )Hg#Y|.Zj{Uq>1$)_:"9)l<$Sd@G x] - fY6``|؞Ϟ|`{ <%R)_Q6֧Ru_}ۉ9;6+ᨡ`Q{ Ƕj^omvW(cl&U͓kDksڴ8xmvz}_vqʢhI>c.,v<Ԅc< q [1a{1*qgqĜRAIe1]͢aLIDd Ea"p-ְtq%tj|`<^ $8F{Q3~k=*,5|j:z{ ᠓i=h6{oUVkV/~ӿL:o^jUqJo^*<=SO”25i%4􍭽li~Hs[odm6;<:񇕯zb>c4tx}V<~w"' T }o.ew>dv[-k5'i>>/y6p"DfC}}[Ypuv3 sO NXLjj\5>֏n;oe6~r~#HXVRԆNcb-,p_ I'9Dâ$`L<ţ FED^ uŹC|2hHnNp.yEcꪧ Rn}k>5-Wz#g'NN#ҡ .$O3JAtcǤ$Z"Z2*9NzQn6:#^mLL8u1[(DrHUM㫓|ȥ;Q9 ("%c0#59(c1:\U!20Rc9Ș 6OQu$4 Nz]r_@:␝SB:Sm9ea$R)AFZK<OK}|`a3 2EQ,Ms` Oip? /5fyV`Sbb9\"C)`! TKfz3*x" ll( {h*;[[ZK6bv0[zgϊ#>Çu;.$^Ch,J~F #x{$0 /E0 OW*{{JbG//4lq}?X:g%`/C:W^ψ@eM S6l-RΑq"aGN_\>䒪\|!$JesJ&`L=x!6cc61l,cH @VKMU lCRTS092U^~<{LЉC{[[$)WK|T)12LwHkfW,n6bǾ>~{9혧T.m/] ߟ՛җs1P `]Ȑ?29<0&FC{t2M'F9X&Ŭ cD" ,GF.:}L|~jC֙}.> B3G'ؖc^2M&T/7l=x]o7Z#-˫{}NCVz_$ tԮt//fE-DΡJ9 sl+eXi8T~=@0ˋXId-%:+{A):G'lT`\M, \b3Bt>JR}ת-9s_/5== 7I {'v{3{c?W OF0*zmc|o`~}|w^z70Mg&t15/+ֿ^0ΩT9_FIr@Zˢp mϐ ߣ@k1q!w7{-hO)/Ng|T[nj}=kv~X"֮}"[=]7q냸R|#fm`&>C)ӌ2*6byX c*1BL%x$l< g)NXtJ)FDu99Qbq9O3i x—`BNAfeiNtBa:0#9`m!MEMzE^.4°R`frYfdfy(j |9/ֆ,ڜ$?I{$9iHhCW 0nI뻣UΥu*0+S|aٜ֟n H?>9;^mǗc=i_/=?E܍؟%7\CPO0(Lĵ@ ttJۿo&[}?gyBc8ƴ[OÆuX w-R %5'q>QW ar5O9rd3B#lQL{mdiT8ur,kN oԍV?%y[V5|F܆{!4im ¹ ZR5Wj!ruMZ[oZT $!pBMD/P†>2OŃI2J!.1;m7`{s)LgNg19mcƦC\j#\bY%2InR%[.7/䠔ϊOF DT{F!C4<e´Fk(vbJ<* :<˂#$v=_ZH`ۘҿ9)*b9,, ga%^yUʪB^[*BRĂ"Ty+/m M-yv^)(B\2)Dru)-v~S.huPNyo\A.Wvv*;{H_\B Qk՚+#PUUÇu}} gEF~Wy[y ~\ 8h]eSDwPQFS1:"Zz n:ҙ}h̤3<̄6 -P@bL1@`l/lPlnպ+jW{]leLi3?;gsH{;Z} WZzxr*gstK]]#f#BzKB>Wa"l`"bHE:zZ Q0`z 3r4l7`ۥlzb\:Ǔ0k`:Rإ&~ mb%T!J??.fhOx'ΨWfC[@ MtwL!5R$ͱq!KЄ)[]?1i`24Ufg걋zyXtxy97V dvzݼHdJ(3k =.ŕ} Vm=s-.uO@c8 481҈kJО)?;hr 2k0A3@bqX8t Vq!`#K2,%6@ݢ EYBƆ H<4É,Z0@&9JbFYL[~G+nZ:b5Nv=6il.Zե\L9 9*;D˕rRZ\q6,N. )٘|ֳ%M[oii`׾dS< yJzVNXj=M з1zJBOֆU~vvnG.ܪDY,RS!3c;8lub Ik''<30C?x9pt!sj0u^9:I1"Ɉq:)5+%d쪮A@M >OR"f9Aqq0n[bANG*Ѹn'0&Vb& ,%tDwp55'`8O=Dq! \dF nGc=Tt R4:w1i .C&P +ii`v*`L(ABC ]ۣ2rI =0|7V<6>{q]v&,eX]QuFإ5= OwE4c%*% b]DTX2Ƒ1>p/70 RIY~2h (]SEvsPՓZ H߷oߒa}x7Z*_M7$73pY/ l$M.Ǘs4W,omF^XKb/pCg.$↼ΗWbS S6!leHwK84~郱>Ip`Z^ z;a1ßܔ> D,pB7 }.\qkӽ·f!S-B8b!{4FpצDؙ0[hu/ֺVpΠ)vU;-ͧMTw4z>.3!|6tWz+_^o:\4Ճ9@5+AvX$y vyp;rĝ NjvM j}QSL54zn^Ovg>zX8?JuzΎy4DIL;pb5Gux>~o5Z-O=5Wڋf M&{)>{,_`KyCKSsme& G r_]1lgTJi믾}P$Y%8Pʨ1Zh#. W޷{Yu.^Ne{^ή.CAr9lTD6Lj.rWn}ϯfqI2!j:>?~k v]\s:E$ g U{pbIstن%vY엯zGrɐ2tZbo/>8(ē;[y5g'*BA.0T&J֞V4tw f:(> 6<*RɸOȊc{M&@o1 > Sw<>&iJz)Z҅@bc ˌq2a t q鄌|"d@rbIs1qbr")Y0 w $%Sa)62ESYޔW匔!, }r27ˣ ldl|ii*ej 1GކaNdvߎޛJ iEФLLkjό]pϹ>/!؅sՍ,Vi 鞨bƱਥe.kX;H |3h"ϫ XCRg~Ej;/:k| a4Vq`~{F鯾+ڝ,iGX iD# ,k&I>T43' σC P*lh ta1tJsŦv GXZʈ)3ƆT)..~wcqVJ)*2QfU*`eи،I)t VժH>)DkE>{ΪF3EZsòA`3šzqd!BH2 9M΀JS$ArTQ]6EEި)QWKjt% h[S%]Qψl\3s)%i/Cb;Oڧ(6&;7mp{./1 Vu 1/dz )Z3$I!cO]SDe2/K0/ j *mtX#E#NÔj!X7;]wG7Q>䣞;=||r|򮉋Kr4:-r%Ȝ"'34$i1{Fخ63OSfR/LL;Nt4ƗvP`c c2KBήvWڕJ{V7$pH&~{v9|爐D.\g@JA'̦!sMz1)(ZعfXZq5Pb\7 h[UNw؅JP]Ph]w:l'Ow.?E mX;ʛҁқ .oYqJegkҰ: DBkHi]/{(bߣ2$N;TWbŷwQãI}M !N\)`$gmD,B.+7ʔ[<%Vb"*m勔Nj@亄]/%V&oE)qq&2ÿDzBvw׷>_\?4jwmJoޚx&&rnt8CX@ϒY_M`4΂u%.)X2A!&+w4gHάYu40/r\c9JӴm*\?HXfIO*m7ĭXSf=k qZq<-/9"!$I 9|U!%Ɗ1ˏ>h|Dl P ^e9"*x "X`EC0$.b,p-cC'l5Gyrԝk{אg_YNۛV0Sн6_.D :=Hh'}*k23xEsά|Z^1hLGLՍ~2MVOG;~r6t ]߮^6v5 =.S)@c΁v̭9ESaKQsyT0,D 4ͨh{1IJ&9-a GX`WhTDUd 𶤀0 )Lր{1i)x?UQC)8 CB{y v9 OA'"SUw5F>Z.SsnW 8ᚾuEDН/ :lAiL3LΧP/2]?5^Uv~IמdI׳.T8vo5Cx-vر M-HGEKa)bZ4dig熈 rZ39nui)-3~{Dۏ=[g-݄5+&PYx }Yʍ%R$tJ-/h|dD+f*q AZ{$N1V[FBKH@tr#:D5 ;H0D ேH#~edObUHZ sx;`R2T^NӊݡŸ\MC.60u6r $ B2EqS199b7.35>B 4.H| \0$?Q޹ĄcjDyN>LYBbP` 0ےQQ2 "(RE! .IF%EkuE\-'%9_-& kU5RRQ(rc7 ǎƸĵ1`l`r5xY. , {^fgvn3WXvGSޢK3[sΜwdFR$*FPI<50;*wP]c0X@h~hUnmvbٞ|aO]|N?#ij WhK|B$4ԾJi!ȺN<d;@'%n5*Xi5p:]Kdu&]O2LjsBmBdc-P ]gAY 5fF~+;[o߿qOwBeE|:;(q{FE. na)03LAF,nEEl~/;PVv *@x7=,d+m/vwv;fq߾}%%|oΡxHKkbd&ͭotZpĩ;Υ3=I &e6~fC.rsݚ_(eFxP>1i0}>1A+n*i*e=()kh#$€*׆)\+ lrnO=02 Fx&ax vM@;Q *-ϣ%0E a(pT @4ie(MFB83^mhj 牙 ʚt?uw)͖'.ݘy'N7xhKsuv*aJ: A"1a7c$/2 SJzMRt(t]"01@spEr]G!!@*E<0P2Hή0'W[kūXcnm<5w村k=͎y/T7l-g&j,T'vza8\_wqѬ&:ͭ=.H}u7/9kcUk}fekۿѪl]&eͩNS?<V#sGv\}5TEsN͗}"kW0[`y^GvX0)tϛe[&& y)1Lن~7W䬋65vpq} ϳ#&^ rz*U1RfQ02Mn$ ހ[OSVVӁ&"YyNߋ?,>*- 4~jrѹGg..V._=2Qls֨7bil=_.BL?q~v{Zsk٭vv3x<\ ~}b񥻧Wo3)\92NqB&޸[qlE=|av٤b=jwu'Xoo[j.~pm@rPB2J\;-V~[+lwN/T8=W0)/ҟ?>s_7trS7CMu[ {ILÐ.0!ҏ$mp ;:K\#SW=*cOB\5`Ae"""Esl$$pԀI4/%#1EXp|Wz%|k; 'G!Ãd!nxBTQ yP{& 2lSǖGQӣe4b=y*Xn(; Cl4$`Ň_Wb)QbkM]/:aUxYp+z8{^:wG_ȦTE6MM׬)<ڟ yTtn,>PـϵDN9<#Ն!Jq;ُp5sH!D {C}x9` ` PiBp7e''aA)p #8Bx䨉1#`@<3S| }uڗ/Z$_cˢY&&8G(O?WxFFSP0AŒKgΜEF- [J7&IN?*HaELgF1\(,-'1>3P?͚e.I.&.nip2P|dx'AZLk5/tV7CA]_lrFB`Jw5ldL*DFȾV{4İ<|JX Ҟr#ޠo*꘤"tMڒ\6NM xG5Wgl5m b]STkofD͝g 7@_-s/w \!çYKFpO?ݼy'dDiNq6a12q' X؏as,[aEEcQ$}mXNSXAQz'%6CuC @p]=?2> ղ\n3ejq \Ɩw>z>(r1C;<`KˎѾp.S%}$60zj'Vn}IfzB蹆 =>{Kӱˮ+γ;Mwϻ>(b.eMn{?a C9r ?v/ӭZ+O>Yr^*L c//YmVF1X=߽(R:"*d&aԼW/r-#!1d𤓵 Z9!rE>*~o 73Qdy=вf륳Lgېt[ʦE9uU9NXV{f%3Rv+75~=RwyF1ިpͷͯ.5X\gWՎR? 7.`5[(dťLn̮x˹Po z1p#ückaudl<'<|gwNT^~:@9v Rbquy%י 5=BX\hsrv>T]:s3J<," U~ov;l!u0^j5inU~jln>tJ">O/J\v釓jX⼳?y?q. eeaZU w$RgxTX0zThAI *x 'Qf@VEP+Y)QR ```,0Ei T yQB Bހ@KYtU]UUBլ~ i^Jÿ烀:%ɴH07І oh}M8kǎ*PKl{({V᠋.x/tc{g4I7n8P{ç~n{Ox7`P}K9[$fI8̱8[VNru2q;]LtN77~xGpnc]A@lQIyx40 _R$udU%PqfphxӦMn*I ^]њE** jP7XTӄLdtBNUZQa aʰ@Bc',8 N8o׎}xٜ>L;}T:::>}|/h{#H&G1Bmgv"M+[Yb[U݌hcuF6xd#lvL0}xIh,k/P^ {= |!$OxI'h^7Ymq鏒8MBA?a`ADkAf86i BEHFF8CkyOd5}UϪfjatb9LSctMcD(N3"Vhh xɤ&y>!IOą8 a\/ /&VĕTFPRPP˨R^[WҙZ_MI^J%`fvǏaet4^J#Qo%-`I; FFiC 7&pZsz[D`p(f e#c\(՝[o7v2؂7KK{ёaVIRNgE kZMǣ pR 885vH{lsiDno-0:f"Ef c3}UPGYrM{o-G/{`z =ᆈtPpIv}v*.-q?@IH4pYa cFxs8"$0 c1 t #41O3ёɩ1@yX$9KsZZݜ}D͙㚞&uCg7OTMxgk(1olB^G hZzg}2ʮZ!,{*?7;?=:1}SMySs +@ @G^vpTw=JL1t!7!so(e8hl}LU,k[AsGm߹Y,3ξ{niYmoQ,B2=VQ8aYC}),IN~9%\eMaR'(q3fsc4Ƌ(9YMfaRMJFh,¶^.#|4. բv+HH %f@U=:쬽998+Ey.,4#Q{>V91:ã Zi ,XtkPT6t3NN?t41j}5(%(*(h}DԠ Ržػ{\Xlmә]C̹ٳN\DT$"]CG@š#Ң$XukK%0wQo pcb0kI&ydi.:IdqgdfWGn|ǎUǫ-,Y\-ܥ??ѥ' -,1Mf>m1*30!,IdkBaGU.1<4qgC{4!OyKs`3,F)ap}}.W {qUa;\ ixIܣlf-sNȉIgӳwm>Gxq ZǸ%D"yT)QOTRL'c IhNb*J-'Hר#;t<\,dҙ"X:T/-e j)RgjNVP7-f_ E.YB@U_Hgs+Q_jEWUi@H `c"XKX i|3dWWs3_V|E6{E1|U Dh MyyyÃ߭óJ3 `e"KӮ f"&E\*:L%O(/,fqu𢐜|6OnoAՕ{L&KoKfCjSN7h}(t0=+aǭ!#gH$JHo17%(bCwlӃ'86ܭlأ|WՆ#_VN7ۧC:ͣjM ci}) l9j;SwZRiiTSabuXUS{&??z<CNrM2`G lcXia?@4-mB Q (5ϣb8C&/}BFoXz[; MfMzkMQP>#>>2HUqgv@Ƣ{:}6v~c\; 6]ث7vαO᧝x~ɷ;.:ZOou&|>4j];*t~ǧ S.?q``jk6'>N9ojw7<~Hua7_;\O<_?:zfF ~ƦLDc C^ի!69}ˊdC4awc-6P@Ę^8ԶnTL1NIxРӑgM$F7ZzZQmE9ՔSǨ"tmS2m^q ok;*Cg-[@U-Q~8#_͝-ve2|d~92fX?wV[?<2{a$(JA{,/,N혡fn쪋6 (=I\pwʇǧKT8~JE0 ˿ b?xUl3}O-ޯ>VR>= ۛ}&8v|3Jc}|u|p xc]-@p:b$T#$#8%/P\" }F\''.'E8xQ 0EwA@xFS!" *s:mb>(1j22$JDN̓D1:n6ЎF`="6#$(i4<*G(MșKoGኪu ʋ7mݼAVhlӏJ ֗Ji&Y\2ybK<fH({u}bB^&ۢ()e \QZ$/٢P%7RRdk C\VV/++--Sn\_\W"/eRE9,fӆڳQ LAݡǁPWsÿ#˿:m8~(׾@-;N(GM-GR$YcnK]AIn.")"\rO.$C )g>hbvߙ!o&LEiaF|anÌpj;f]?iv "sՐW`l, f/[;_/Ex)Z:T4<ʃ]@Ph8UW%8AUJFdUjssr S+MEy2vLN$U3*ep%0wa'54Jj~RۋQBN,YUgةlnjl񵩠q.pje^s$AKtD"`.ƿv9 Vk5HZPx1E86s ?>3 NFY6r@&"ZN;B|f9NCKs6EYv'fC`DfH"Hgs6}OtM^Xmp<34xŚE\뱌y֬, )p526H@kAIJHԲ *R&ʥꬒ,(r.D΀Sy82J!һB^)b.P.<nBf/͕25@:WZwKJ)_I\U[ofmm$+›R^\ TD uщ2>pY,3s4^o>9B/z A** D&eoՈև>\ I@ԩ]% l.@רJ|*YgW<2TI9I+ mKJTdR+yÂ2 'X 'ӲR) et1ɅޖNscܬ?4pWY9)!ZS1VĴnLؘhzm±w'f1Bu?s7T@':BX$q2:hrGT}uySsk;}/4/ε};rk. :Wضpø!j~lz-3nֿ9KM{4/nSpsg#\ˡVkW6Fj >oq?GGyIB$htl.Nb3(p5t Ms*(%8u2zt4Y.Y%6o(y<т!HRE.lyNX60м9u|s36'n؊.fO[6箁kab~.ѱT$Pe{ekxf ϚOlڵx/VgBTG|U8wW˯z Ufٴ{rKˍ;jKe»697'}PG__m4_nwdٽ?t{om4 bMOl -ΝDs Z\р@xȟŪ .ϱ4;7{pS7`~7#n6N3B:SPy%vFiw2CfJ~6Lrair:Ltw6mijNot^%MrxV3GGeq00]}:87 q_6e,6tyxͻ;;!=i'R9> &y9 77S+}Ǹ>6 qߜLѹ0TT {JZXgz}j]VǓ'k.CMr^-UH%5A"+qw& =rmjs`0y>jjw۳Bok='d >}ׯO|:gҶHl?1ɘw$査HG'l]S{֓**Toq` ̴/6O8m"?>}7= C68ՠ_I06$D-Kj H[B1@k0AU[@_ $ƄtTR|9@pǸ_2څ 8gIat=jAfVÐs4B-^,*jIԯo~Ǐ9r7Z]sk<_O٧bY{?[8i:kx2Fv1}n}*m4J&am m64! FB `0w:_x:OD42<9w6YQp$},6V/ P5ˏfG-eCO/<.{KӟP?{B)'8 I{ EƤ8#>µ-CёR@뤔JșN&BeSr.)"Z'e(O"]2D6Mr|.""TȖJAn~BT̗|iZU~0]кT( KE([qTB%.($Eio+[T4^V`㝊rKH;ɷ*ظowW!yoDqe.];t 4I Էnx^xE%=-ŀ[Bū*rlmx-sT3/|6Վ0O ]P%vPS˝RuG4s^,[h[,2?Gտ7c&`C{}vssݖ!' }a뱅I Ii)ڽ@`o@ONYPi.9:/-2f6Ḟč<FÛix-}p7=5J&V}нN;FqSFm͸k^hk:zcWʃ-[71='CK`<$̸ZWY1hDYpf8~4@0Fl5P|"#,qu{yb Z,JGW>چw3V""n9zң[kmgV^BPܼɞ>ϼH 7[W'N>Rց݋f-Ǎ;G46h@unYu/6//O?rtkX?z粱]{ ӣ?=^[fOj&\Ќ3Yl{k\;41ؠց5\;r%`W)`aON]h4E9lplqY^팧jjy#<,vP ?{/P4VD>#ً{Qiyb)ruXDZ+ԪavZ=o2.ᆗ;v[_Y%w~nX:8l73T{3`[\nhرc@0CDbXXLITF0 x v~%oc4 KE>G7ЍCB k:Z^Y=4$#~i&XJÓ+c/}AتN{`fiHT?zۅOإcE2:OO7aoYve8nPxk C ej1p0{Snws<i>zK na'>Ƅ,0L a,E!bũqhmčReF-QY>ъA4).%]?=ղ| PX{(k?GM%Hς+FP\b";<4[])c |<IDd4 x,$!b1u:I%bd$xU,JʥӀB&@6P!WC`ez>]̧b.niu+qQ8]}jΝ?=F|>*lbT,npEf#NO7%]B20w @^FT."Z#J.m=j|,+ ix .?͍22XFFV/o oGkt] `,֞ߵkJ ,UWoK3[%4 4|)Iz/&#JqÒ0p y.zK/CNBy1Y(g Z LּLh¹tb:&b%6-?M7o8ov;MKUXqa9W)ϲܮk5bJC s.R~|tk~lk5Ҫ#k,v>-0=/w&~ x^=&_]+fO&腥./`Fܫ[møںv{ Bװtu3@c8{~X߸vFjjaAw~ZL}>90;xM?ٍh1w_7Vz&iV_YCkuW*OU7KX}zl $n}SX1R\sB{j=kcJMh[d-ډ6pë5g53OգMGu =fU'rN_A|)!% 0D&$X%eS$!Yh:3/ŃӉt.xJ B:_ 9Ttݵ]3O3ER`*@5MbѸ7Cէd43{uj9Zk r^;l~+?>'N\!&LF5L@OJ~?iXj"ϛ+W`Z(dP^!heĬe)0Y,rmv4;u_j&^G )[JL!òp"T< f}DHס@mQ-Ek՛ι+A5sRrXiMqmM ?T]sXB}A33r&-d1H7#1fo }QK)k*um-#>|:eyWmm\syЂ$)ZwٴoI:l(Dh6 6J=~lqk=i?o4~ϓsx4 ƃR`u-I'?shkel:_Yyzq M>4[|?\xg͆}&'cyU'JhĻXG=;,6>lt-m֭G^lc4<ف-I(mbgy4_"lh'T#_8a8x0a +:l+@_H YQE^C9ZBeYW 5તb!\d矯(a3<4?YR,9)O7]qWmϣqP@es-[+eBPHRL.Ѫ"Q=R-Jr6K!/%*|^LP FמW_d\ou|\MvSflM1!z+`tЬ;Յ |[s4a<#>FPxFبӢ@ ,FPeN9".ֳDc[| tt/wL]SAk3v+xw >ѠlӰd]AlBQDd#Qc i5BKDdpe -ʼ(1N3l|J pDgLr4;R=4TVR8QzЊsr So?f?8i;EVz@G/l'6e _xt}_ٯ{?^dgn|~q9UύO7Z.w -L6ߕw?jt=}}\][TNsR8&$8EqśeO-gM|dl9/O\Ie ܋MceS[!8A ~xm׾qǦvl;0$dGQTވl | .줘8ҵ1zɜFPs4G+*2z`q)RmR)d+lX(AhJQw #GLN #R;DA 7[g\.no<^p+o:vj'vJR-˙R\-ȸ6wt]v}9x]#턹3ŽɝhnnOFzjRZR؉tY-mܘe\ל* x;?+J]O oνj%F&UbjYZ-&Ew+n!'.\ v k:߽hMҽwuMGL`>Nx*0?tilj]DOЪ@eCCUv ˲)+]I B 'qcǷg5o[YҕlZͦ,j.֖$HXz91P 躸PYCήsPVc\.}w;o52yk`a`{-yݒ662$E:֑x_@QR(,v0my{cӽݕ{}iyPa^X3zߢ5u%EE'nXz²ai[>Go`zpX]fٌ.jMz&JKy輞_XY!%uLȓ˨ZN"KDӔYMO/LoWogm=Wc({5X~GhgMD,'9I C-}Ae03b$߉bx8c$K'8*' P:;EB82ǝ.u ɾ⣡Z[ihw4}3jkeIsĜa\bQޱ>{:`Y^TDTE .5 l`[Vh ,8-Pd*y mXFEA^ +'J$qrND`oqEVcH[A{D o'~h.Zmh9fjS_lvMCȧ.=8v{е}OO:55E]&h옹Wg-]W\w?] Dj/+fxk^>]o;mqby*r̳?X*X8%q?^gg*N7z{'USXns8ˋGj/,-81!|Ka(>#([M:;;9LqdiVT@J apXKCpȧuH{3v##Q#2SZylvy hj9RHsE)q.~E j< HY92S3w/&;2S399 o# ۶mз]^+K+K Y/|'rbeɅg<37OɊ@om}u%6[,zp9du6!U-qy5jX;> ڠ5Lw>a2#9^]R2\( QNc۶`}2 _ tXCR kK6]ZYi.Y;Nsz39G+/I>eYuSR(Q(QKdRˀC1v ?G$Qo-.:F㺻*/S֎SG<0 ܮED Í_ԏvJ?"N!ZQ r[W֓L86|ngq] 5vjz*m|㠩7ntZmtoM+CZ*x٣Ǝ4W'͚*c\T:r1F%.@!@,-!Bc79;}(B17#Y5Â#Kj15?CZ]QI)^PH[&d?D5ZwiށA?@,E(`j]|M};r o9l왨#!Mb=A{qaBvSs$6wl[# ߟyrv]鷴Wϸ!+8~]uhٹ&~~'T΅V-Գd(EXEk?LA| rQo!4ք9WgՔk6t8^316P`[~XASyphdǎO8 ` FDj@ "iK[fF G RfޔVnbSV \J nf+Fds2H )}ؿgnD:˒Rج)`3vukZm۶J&-oB1!Kq`rńs!0;޶߰g{IM[ێϿ$U烺t JP4fb,OAN11 **c~jP62( m(F+"Q'nG!TkMvX AfX ]G7C*TxovwiI\ZҒ]u"BJb6NfSr6 NBZI'f^׬r* l"|n*.VJdyQQ;w>hlikE$R~ VZP֊pXR\B-TD\nlt\:@csh7 xF}V7t7w7~˨ oQNt`2l^)~UYB5ϯfe0v^(椢w|<'1ļ[( E)[LeK++i9RzT/r)sjxQ]krtb&4~O'?vm#9Y1}oO FxQp39N[l4bh\9ZrΓø~̯ Ixp͡niQz+0Ќ}D1 ӆfor''_TlO}aE׌Q;"r,zQYiȉma 221HGp0,0l<*J cʬGP$ b|(CřHfn"|^V cy2" mh'`zMsbݗӆ_, \XN|h̞ݷͷZ)\4](ᷱ:]q[u¨~mi2{zY󻹆zg'szi%rQW9{xvqc[Nf{{:oOa1-lZ3QŒ G<l5CcV61_;?ȉcR7WiL|vk]NwӉWN<;77^m yX>̹,tI[ش,];wjACY a@KF$t]e*$a$3l: 35Ki)3^,B{XX g% $3*ZHׅ/.Wꌅp`OGYWrb./ |1%L~foteo!]){1e7rZ3w}MgmW>Լ}?|$)BiM8^r͟[GQJVZr>4r7T{o]lIGƁ~=خ;O:ҎݙζagWmUuUT \䢠"!$ܓs/ I>t};}|wEGϩt,=^%ө@s( *JHtۛ(.,pJ%,J`6 62\"'䗐BQR-@nZc`V[rvꤵ0uc[fWR! OD~yԡGp0=&!> 5p= ]t?,b`Q` $Fj ^JX)BG{Gȧ?Z?Z7U87h͕>kO_#κ?0W|/̚Cr囿w^g?Y^O`cjR@)BUAэ-ӼDn1(3@x,nùXBTy k;d$$s7C"J8ɢJ}R#X\YOMM" ne$p$t]FlwΟ{vry&z%N1^x_L]4H5]~~w[L4}0%qQ$.g3i:`OUM.zz3^~l Lj {8f\3jjf a%&;&WUM =0U؁ִ<|&)4'F 32К3NJ0K",m (XWBGE^ߪHVдdW--(JO|1LUKիQ]R*8*Rf,2BIy[TQZh][['ԇND8_+]R[v#)J$gM/mR-u?ԧo*j7_7y]m3OAx+8'] QTe( ,ˉtc@@Ehvg<aWs_xo:(JhU"8VV C56+[ۅoQgEρi+u&˃>ƽYsfٙ[[؀1Mcr9$&HlR"d1H3I *T:QZ3 5@ ^K+kZFA I粩u5T\z=Qs]Zsv<:Wh9a]ytvniL_`qqTsxԤip1v\Xj:k1P{s8}aq%g"rPF$t L_jl_s?6[4H9p}gN=xzZMs!pΙɩs_UcC(6hK(64B|L.-0Gcdb6)gT6dI5$h{cR;BlPLTsLZJ%"h11S]~wQImfs9nF𸍍htOTNgLKoaoV}2vWW>i4G~']lZ۶u%m{J躵+ 5IeK6k/c:ve-[eɲ%QwR" %J$EJnɶg qR`+pppL2u;۾?׺W$Sypffӯ^:JXS~m|nM5Xl Tѧ7ʟkگzzx_, ӏȚEsY5gd0}Xl&KEuigg+  gqLGyUI34ֳZZn@n,g}e@$m[ᘮw.Bylꔧ oMV{9Yb CQ!f_3Le#4Χlʏni)LI;:uKuD Vր{G1u-1Y9<1u }瘣g">q?z5rFkMoX/jSL2\1b6 '9 VԐ eȚBjrPֵ,g8vR&mqTC $p= %U6 G&:.\]o}Y&lsGm5n}g[ekg;@ F 7w:I9@JfRʀa$gfFX)0Q%(R9&-caX:-+Fs>LŸe #Z'\I$eyA)eMpV1|QL.\̬fh^<]otF~рŰSZ ꬋI#I}ot1]q|!U tvƳ&Un l>hxԾ=(1)%ᴛL?` >?~S퍱"Ts j4*2YUvvsࢄ.j+ I؀)E54Dyf ]Xޒs/Q 7 *`Ge(lRWgB." 4jt>+2ԩ T5z:h mFn{|qcU z  \]\xV9)B),v7J[0(AaFrFj `"p|{׀1^^{^X CU%mkoLJWOOo޼yofV^,I$}M7*S+.}0)ÌpУ*bVN{/c5sاz~7ׯB~c-+S3cڞIJy5JV?-ep^Pަ:S4aoW 6f mv6\!X,bqaKPz_\q ,D[ AW͇siaE<ǀ3#dnG_dє*ZWA8e*<ۿeXy8~#Y:}q:̻BF?1*eocSg*4-c!KwZj3UR5=*twhnP3$vh?**ȱ SDqb[[25'*ێgo9?MPvmO QA ip/@ +b ;/$Q+Ι1_J]9I~&i|Fi޹$ qA& ( eѣ%%oڵ720DZbݒJG·2D= [_v| {t^넥PjQ^M4}dvH[[jj(3=dz\n ;sPs]s8r9=Jr{}cDcquZsa/_s0CyL& 5>bM$DZsqTЭ;GYEzNM~i=h>bh9fn..ǛZK Bc+L;)pi.+qwh޽o~EDhdc8LH" z`tRQg9@F %*CAR,- aS_Yϊ03XLT huTO\B"- 9'a!!/JHApWFK I/y>҃/vb+>}ǢgH NI4ٖZ|瓰N;̳IX"{r4jŕdۢMMXe2b!ԄDn٤tli_,gBZg>+򹔐M&s"l&QS r*EWωL~\YG΀7VsZvsmr@ʦ%{L*t]\ HlNv]x^,]@.nm!oIMhl@ `ovA7w_lBA䲓,^HNg9l.JF#w-{JJJߟ^쎱[/_no|ukd{.G8/JFGW#o mmWlЕb+gt0c(6 .E,5Ř'5~Q0ý!^zh*9lg67?BKA{òw 1t WׇMu؝=vwMxaQTI2ڃGL NbΣMSsO_ziqȎO6|8!0ji+ս׵z+3yDyKu庋)+*(+>kX׻k?9Tz B wOo33rؑlVa7Ɏ4 xqb򱦧4jo~V#dVCu>7?uU&qȯM?ܻnن/-;f[E(wX̡1߭QLҏ?f==䅲gvM%M~#$ Zw֞X-W3k0쩭rWfɝ?o⚻kWmaOw횛Qvsfނ83vLv/w<]᪻岯"Q{lW`!/kK++|NcmG]]'Ԁ,._\\rxKUIWx&&@!'Q̉ǻBxb?f'G$ dcH"Db.Wj~qei TBT])xܩh@٨_Eⷀ*m'@W({c7^YxTM5v#y/!gxʍ6/:t ӍtSyc M[Lo -2WCYN+[O2|u~3{G3j#؟c7G̗Sd쓟^&pc?y]7_Y`dp~|:0Xߠ$dE7FGp[jV6 »YXt$#1RA ?B[Sed>Wk籉(Gr([59;9~ U>I|17km|o?>^:q©)O‚dBQaɨ@Hl;kmbjC>gMlOշߙ$Szmj?t|jk9 {?Tf=sdq=ch 7}@!P5*j􁃇v 膓u@\& Y_4̦B&iu YaUAMmnN´qA\=~  4Y4H@e!f\XƷmd@G7'8[kεW/4^5|foZ0|<% 5js~ ɤ 74AYqSHk,G6"h=W1VRVUP̀4ꛭ .ZEjW+ GlvZ.O| 8 q'3.+SNBE]ntPńN2L#]'3@NiKk9PT.^ZR@Ejr1 2˹EyxP^CF^]έȯsYxرZU E(Uk"UJ *HIRadmQ\-JHK(EXfEqÀWh*`c`C/6 KC| }Q4ӖܻG<]_"'okcMolH_m{!G޼]xKt_ q!#9:z;<}ԖM4]BvQerNNOK#wT\QHGi­Z䱡6#H\f%/)̫ͫoEMN_htyTNy$w1o~oe OJ,rLh L@"$07|97 < ϶Sm>`x6=-̈́38;ĚnzΎFb6Stp0gyS`~2d Q#{6M`=rzcx3.UP*:fQokWW!ؘ0R8"bXwƢ$IAVV uQQdmUNRVdBȞh'pJg:gy?'xYRTF2ɋ2'* I @R*BTT +h[IMG5v[K^]z>0roa q=߳.`x'Z/r3IK mDssqh;眨\%vLFA"d8:!y=` tdn&;uBESYSMuQЪ1DF)o! RҦBCB@7q[f'cv~緳Ͼ|;NllisIN9>J9Ӛ5;ۗ5r%𶫆3>94[) h]ɿ|n<Lm[jo?R6m]~z^}j[o۷7 D.`֐Pr)1r]( k_ p[ nfS$ 3P2q:xD0&u>Hx;Puqc\`lΚ:ͧy< L>/|-|nPxTlviObCmS#+7N:k7tWW HP֛QvX_X4RP&Nf72ZT0ǔi12={ɹ趎EoYKL(Ix|g]/ێ7.9=ӓվ5XwMmrSWG+{~mk:h>l#0]}vmc9x5~qҾ;0LwYjvvu󳽻wޱc=6R;+p4h nir?EDÂ0!gssegUK5hOYO,y݊u1qM넃l.EhSl}33t_vOaVw`$'Fbꉟ{{շ+O,p:'q1@DsQΡSGhd?I+! y|I2r;F׆u[싦sŦgQE %p5'$Y>&o\-v̹k׮3g@`W|q<DdcGGH!D@Fm O2bs@)S5 >>y<+M7)"ZhY"~fn3s yVКh$ /Y鐒$`{Z[v.<-Snc8:rm»61+gp]=u"V#].D2HQva| H| Zi ' dla[, @W9K?JRPxSG.2 z~S(i]s.RtI2B X:-չ l,B&Ϥ t>@jiF>ms#S,dK/>ݳgxl @PoJBi3/W.8mBƗK[Yڨޔ-],F UX ]!˛pD1"*P.+`WW9]te6"7Ѻ+{Q)2?6Էu]yR䓝;w.-Dsyve@2\t y J/`),,3~(E'[v ٖپމ&cAc|*H ʼ9b)0bXrT=O/LӪ/z]O&/|&[_91W٬646^! iu4MFx SP4hP CVתU`4DlAMYzʵXr;86ҷߪuc׬=k-tUg[K:%GET׮#1SW^ WUISwq֮jv;Px61r+IEc|8q._K_`nfi"6>Hy8IDk\4SXD'&goKVV`qG݄|cOsU5Jܓj:dgɥ{I}Ꚁk~:e^am&x:Kכ[%A`RUd%Fm)ĭ僚֙m`-[˱9情LX]PZ~z>U fP#lnB-ʝ?oZRMd4i#m%&#o^V{&+]N랭>/^nBqgcuw]mɏ_kzar#;?8miOK.Fʱ˶fY itpLV%VɯWV!꘮};dG8{NZ_j ^V%c-G l˵^6ksOhyH3~Pʼn$+,d06HX[xKq"Np=Ahq Alƨ᡽0@0Y=Rk@79ts(N`{Pq`WJ= ohn|=}I}W`6rg"rGc4A(hyGJI &:H{A9C?zE$e/wzIs65w8q* -<'b=>CQʳٯo$HLk+Ɖrs37QRs[nG‘8}ƁYh'0ȥ+W͉yNdd |z@0g`Mp' n<62402AEByZlJd9/_׸1g p?t ƀ BEKcIn/F8\_װ/p51++-Y g5C" Trreƫ 2R7E˻|kDxT0) C,bv sE e0G}1HeD9D".v^b;YzMfqlKrq (]@뀹ƣ^D y5,_ԛ/߄,GzMjT7mi"+[h95VqI>Y￾zjLjQp\PXpB 4puNkDD}kkt.eRYxfnMtu0;L֒Zmdi56hg;.U,nZK l:ɦcLr+}dh@X14b dpf2ٿ~cERԪFs/q5N+Rgt5:½.&; 2dBO`(jU{in5m2ݣs|'ѽtUw?\4)vgwDw@?PWk,˪F:WڛuPNm*R+ra閡RU+n(l)KE6.p>ϰ2GN{C!q cb/uuX(𱇢 qNv\ر۠ސ*vڎAdɶXljZiR %Hq_Fs8Cr IQ$Z EEm[7TRa0y 8"Ǔ)1Y!EHIhi-J/Na% ذ(JD ;@jb{Ճǎ0s ,K]g6Hxıebnj[M)&lT v7لO4bgt71tvOvݕKsN BTƘP4("~*fB17?p3~mƦOj -s3\1ᩳo<0':n̶ս_37|jsmKkyY{G_O`URAP!eAgӅl '&Scu-Sx/IF3B"Za3IӱXBHYإBM{y}aP1!sJfrՍVXܜp}u^m1۬`go"}~ӿ9r_nd"9n1>$ʮrgΠE9Kkeącx1r'mJ}͉5嵍]NT(r m(2`!R:b w+s N!% k>_wi;g>M#946V-o񸖽x%?Xܮk<]pl98s~6=oO۶ n] \1p7~ Ӫhj6 594ϺTbxt4xޱ}Ft!ѓ{??‡2|UsXsxuMK)BqJIW1W12LnV@׾8Q,Tl4~i dty㌊1YbZxW^UU3D0iB*r޻Gk4-cHײI_rRw+#3.- yIPH4\k?Hc'/8<bqƌ,G]0<5M6,k.}XD݀t?_\ImQa^9$5%xE1T8tzGr+|7#N|;\Zk'ا 6wkv=Ŷ`e~ݹ_O{/-Hm4QNU)S 8p5i4g@2*$l]m])E0Yi."ȥtjOi)Kz"XBtfO{& LNfVAx dE‘HbhI<-geՔB،}OdT<͖Zg lrd2My"/]>e1|.b.8E~AMOvLuGwv_ Mc&,E]Fg8r| #QCj=Y離 *@߉h*ISh"tv _7oq0/<3&?令EGK 'kMfc,:g*P,fWg\6Z.d\]I&TZQ"Nr Fns;nUUUڸ-mDFbAA5ҵMDk@zкXTo).C9P8 aKu]rwPJ"py&KI/v˻ Am;nUh]FU(NI䃯~{Aӡ{[KKr%,B2 )ޭl&o+cGq jVܔ qT%P/ XOz.e3ET楰^3('("̺ 1e!-n|ݴ?H[K=͎u$c$Vw.u<v0τxF! s؃yM$ga{IGQʳrβĘjeׯ%f 5}7%d Ze\SıOO~7z^{v:B>I4EDQC (i )`ֱc!0`|smf9vcgf]_>T 7k>ҧ71Ё9v8a=%|43UTQjPYHbV$EE$F00}ɀYpBt( E-1wCjgG-I '/6 ï[POŀ6B^E֏(Ey7) H`닙ĞGf΅g3F7K޾lo5߽hbQK_9CM?.8j'l0U+G|ff>Cn7wn^Z{g,G|?~gy2R{0lKČ L\:Mk4ƻq-^+E@)ht8i딟M4&J( G)j6kB:G%I{""Kj)UQX,y ZNY{x{jsT-lA~lbd.)`$W9GZZѕk妈9YRSnC_FT\ӽ:+d1z zҚ,y*ϳVsD-Bu`m`X^{D]oY䛮 ,cmXm+"P/BOOG>A~zZuPCɨy^ya0 37f/X;՘~x3p>.j'VsKJ탥l{5^75t=wػ[vԡ꣝/.|0 "&(UFg-/\ͤqRbǹm,NXY= D ؠUb :g4_/m,K"&:L"'Ȭɪ6J`R;Dw۳w/N|@34Qt`:Vz]w  0*U@x\nPƲ!n^v@W+6UWV"@SYKd,W*g8#<1]ہ^Tm_ԧhdUGKNWd;ٻ:{zCsm5OLA:MG+v+3u: {NcA2EI6o,C(jOFW(H8Q_?-Lq0+Z K) r2R(KxQt(8󠡘9Y]- ;@̦V_`YmQ/2"1~340wx1 *$H`1$2^;wPˑ6G;wiEJ+bFғ(LW)<(9-hIJ>jqU.2|Xȕ sk ]p~ݟ?u;@a꺼V,Ripuz\2[7JqC/륭J 0`-2 &C` ]]љ ~]\u2 PҺ!7 l66aق]t)++"O}`=oq ڀ2>>303[Aٯ{ *˳N`r>"Cd% #r 64q|f-W(KW\,HLKr#}k]˯,R]xڻB++VW v{c&4 w]mW "JN<#pE rq'f/u۶y AS`ŰR`.Zɺ&Nbk4$s^O8SR;ۉmb'>$Y>$˲(Q(R)(lɒ6! lؿ //?~d}O6N .]zT UgU׷,\?`lٷ'kÇ~&vyȒe"^ܶXN/N{en>cMBTʣ'JJEEdo,2 i{X`<Ȋه;H>W8rx\dgK Eb(;/8> "Ƌ^ ގp S -;vhirBLl1[^}olxsic^`;u͎=$ [mI=Ҁ3ccU L!N:$396\*o*ZF. |硶T wշrR*S֙j\K=9g`ڰpmMLwU8BŽ`.ީcsdiL?7?J9F"=G=:jug\S]԰*V3=֛9f.'mK!{uCϖwGX]]Ɔ@oypJnl~$f3s3T1)nA,"k2H̊))VpR 2q>I$E$.^dl= UhŁ_lhܹ@/|C4dPuK㒈Hh7g3%9:ƪ&s/{Ǝ-F0#8 Oy^u|V\;==+WX0`Tey IXBtB5a崲N)n~†ِ?)(VBRh-2J }|^ac$Gy8"M:bA1<Lk<}cxXN~<B;gBnmu]ICKO X5 .γa!j=I-DZ?КS -(YD@h*"~$4n%QOu'|PptXc"&xFD,tϴ;>p{M~3Wb&-fЀi)`'h$lr-gSk\dsjy-^ˣ]Q8vfK/}'S@1h+V b%tXtTi,T6Pln+J\*7l:yR*+D ,PGކf B2LK%EhΗɠM-$m2T6*u7oT+`o8VYn{o ~x Qnl'R oU WWoVeꕍr1y>-oglL!"Qz1K3Ԝdh%`̍u鉱[2DŽ !/e%i+_{sFOtil_ *TvwcaRXeYZH!Д6,q%ssٛIlljk؞c{f9Dxhp=rZ:x17tONS{cŴ#gw=.3]eOϕ}Tst[W|cێxxc |F^:G lQݲ O# 'C "4VBQK(N"*'CA.HC *(`"Fʅ%othe%IX-a-&rLCo\e!"R‘8#vu!7A%$A rx\Ðsl@S6?\Hl q>ɶTj1Ldw{6MZBz,쏂E"<'N'+@ ]t7[ʧ}l[APpfnY#pO/Ϟ4UeXe^ht؇0۰3ě{V󃲱};N0b^}G?v6_I1LfTeAG IBD8(< ͆@L|AN-gҐJh~"cr&1*DXb8^,Jr ^KPI"^]Y)rOdVKϥ h#Uˠ"6:W8}i_r:zc|N{b4Qٕ E0f9il&oh+*Ms_U/ylL_Ʀ\*L*ח1|! UTV(ʓœ*𤸈*'1TWa^\-,R9@VAE8__/|g'Kުٶ0ow36@؛@Ͻg1j7^aZ9COf14ScGنM>RiuXceh407Ud9:dmf_^&k}N]/[']e 1=~7Xs o>8V{ACX;Or|!6V$` 8iV5߂U"k֐ #܈cKWon]߼51i"İCZѢI$g0p"<#ãbR|r$mH gNg1T 5Po:l(w?t]Ql2{5cCXwq׵N;I#Gx`x!N˾oߨ9[l}c-hA<( ŭgk^d<8|6꜋y"geI:gꢃpQS$#-ք]]Z[moFqE8!MhI)*Ti؝Ox+'ʪ(+Dmm$UKMIDM\4ckRU5'l5"B,HjZ B ^3kG%3ڸ)aHGQ墤+Ť <2%Ex u4OkPF/?B5b6,tF;|xEuܰkx&Kc}f#k=g6Jb<ቹzuUy z\BXn`XPK!'[O0ivJG6LẠÚ͢$*ЩAԲ,E%tXY>+*Yj$11T埯@Б⡳ ['"r2: F4j;a"9ߴ]|ۍQ{vC{ՋA+B/y9yNy ;:Af~'q2L,$MLZfl:ZUɥT:Cnݨܾ}޽{/' Euay1Xȡɪsj@*pY&BqmE,&kkgI;QGК<w @Xb Y3-Q.mYE_/%#fo66Js8 /mQa,]|W)-0XZZ36K (_̿Z+fSIw"WrlƼ]],w1.^ICSfU:LF{Z.toSitQf4RČ 0"aaOB@X $@ B ;v^w_}%qY>Vj;7@#Yǟ=ߗR}*$e_lpk=PcMJx'r\q9\LU@54rՔ??thwkbc)tG8؎&ȓ:dehnbG1))LI5R!'wT>^/MEF镻5ֿ}Qo'~}]Ãݎ3[$kHH@k`d$l"@*ݮi8/im&i4+B3:l!&QՃJqٰx+AU :U9QI&'jS9r u}羳ol]~[qxxO(?>RqlW9>c`Lh8EeewxKE _]\[õk֔q)e,+ Ļeκs]Hr\p qΦ3EI#JWbqC -0,ggfbl6Ϙr2]-ffs9v.VI15?>w!OIoiH6nzsP#k5LeA;,tjݯ֍ rsm:Mc:P|b6Ȧiܻ}}T>v^eWǤq(( 9ʉ6tGh [#L| raa! Q9a.9C)N3ʁvD)#ex;;5l`=ssަ=5tW}q$~;Z`wwxor>Eq}坮K_9)[L-;Xh{?K)E`Sdύ@%yzG)r{f𲖽{oC u˽RӮjq)9Tͼ@\D&ϙWL4l7%mcWh) 8"j 7FqJDCi._{͛k'!ŌçbhuH` xk̶mH(- HoO-% &gEA6PE\D %!:No#c X?t$>pJGudA/+6au5~?X5x{yĎH)8Rq)NU=CѷIn$%'r0:H-@:eل@= 6:O?4&0: ^,;iqb{xd`Ž<\Q)8SӮNi3>>Ǣ-g^P42!>t- O*,>e<<1:"X5x+{:X-ib3騗Q5C?VUU=htl280Mx|8P둫JIZ+BoD6uَ0%{?|'wjO;$6^(EE ޒ#[R(eKip5;gf:a:mNZSlʦ3@NJQCW޹O8o瑫<<:_W糅\yՅlu. 'C q5@M@\Bޞbކza ^-hyiqqi5-"",X^. /*Ћ? ϤS\^*\zclfc,!S+@«+f>jlSjjVLQ\rf2tl`Md>;,S-PH$b75:m&ucÖX#$ˊmݖJ:H)x/)rOAQDR$%-"R/R`ݝ!)Q|J.̥7{VTMp_n0qVf6H?Wӊv;;`^9o[ .op= H&*F\72=Kd5pw3Z 69j-0iRGPA# 6L狺 #ZPD8-EybD_r BTAL Ȑ8 8AYQ"b}hHRb4Zၾ 0"AaNxex2 n5OjG!1@EVBnb! \,Ơj@Zi RaXVHǘ<'\ " #EDžhΠxwjܨ+yitם2TYݰ^trdfjΙo>:2*/_ zα ]es* œu'&Jn}6qrziig'gs aJ,{k}uHTH)8-MS-pQkmMQxL.*J+r$Jt„hXŽNo7Sd2OdSt*c'D+ FSö0%"有6 SBn &|JkCwbqkn}:~Yt*^HRJ*[Jڎ4[~\ӑDdZIg+ϱKMĝ+- ;D wSZH!0[sYHb}7-sy-(`Ƶdg5l#CesNQL "[#e75G1A{< EbG3]1M 5Ҙΰ&8N Dyw%X~cx3P[dم}2^M/:JSD= +zO M.Y/{ ) LFO {[>6&r[5-)FE.uމEOv={~;>zTڊVYEcԸR0jY08_h0Rc3jǂai26Q([=<~;[7;h?vw  4c{P˵RUGET7~Ʊ?,6G_t_,2vȻc:m":1{rkPK}3;L NJ<̀|d\OCY4yk-Ci(iB~kػwoII$Uɒ$+D$Ǒٲ (S5Q'4*RM24ҬYZ/ c`68* .![jQIW|\ hEI(aeQY[QNa^A+yr`n(̠k>p`-Ic겶e`SS+fo5gnٌC4tp4.?!+ue9f,Z=v7qG'ҔX?%,Ǹ[O!滽!=8H1Y%x~(Wᡖq"xvFǰ'~l Q뀥ETʢ,2C̆+qC~_]o`.Y-C6ͱƮej3[;])7IR@(ƎF)XIJhJ61r*O;:e]<нwlӷf[_p};ow_?85@ QP .G"^vSg(w,Z+C1.8 h1|S$ "pOH|e,'huD9Q1P6EGWhN!U$8S/D)O>(=mP{qboH2FC\" `5/C[|A B.  @R 2YA5Da Qg8-P(AD4A`R$0BͿQ^>s|ZV9.4Z=i:0ަGvwL68uJ30=6\xIݤk֨kƾeˈ:k 687ܷkxӝmKozjܾH%%4"qZeHdy1S<&m:0!$\$Sl$rX%E!āb!s|&_.R ')"9UR5(%rg>eWDƥ&Xnut`ˡ{~ %b+8&l[ܲ2B>d \&f|N(Ùvfŧ yx樥{uabVi&.k~#W LV,(hYS`\EAZ)Ns3G UO5Brr^Qה+zߥ)Oegnx_? K/n>{ ӿ4q#8':Xgi|,:m=Sm5m{1dot4y7tmn&&耎#M,.tlo5vQ [ CKw~4Q'[n[{Kug~bG>kX>xs_hv5u#ͫ:OD6"Dgi5 e2"}vk:; n޺iܣcW<3,gO;m\3ļ&0̎H9\B` 6 2D`(ݜ7lրy(ZMFЭp*)HIřh *+)VtZamBp.+TDLʹr.:WVt l6bdTEd{g3erԭ*FN!W˨2=HzWA"?kb.O;2AĒ6Sa.7hzනSK!E =\1]yܨ X$zr۩}QKXPJJaTox+ D !V<JDr$N%!;C.9c Cb2u T|B #Kl\ <OeȉDZbQrr?ǿO~ޮf=w8O:‘+35ö )Ff,&bP0$4r5Mt< W|6OL]̤ xlyݺX,dW 駨]#T9(boU@kHLmRA*%0vR\֍]!H ZQUs๊8ZSv`m]шUDZ @E-ˏVV*)FI(0:GE5J=zJBI]6Br).)ʪ4^yV*_>=kPx̧cY!ZD +EG1BX,e2 'O $("W-Zo_=WpsGNc۶%ðvaZ4hAinm[%ݜM$N4c/_ql}%dݢDݲ(Q(RHla 0 }X?QZLٺkguuczr'3k 1< A\hemu1ެfe97?V\i8eY%mʆcg["p5iXGk~~o|&Hnqfݵ]ḏEd`VZ^B4[+lJ &P"-ˋM<-@Bч 8eBM+)A(aO#Ó4 nb$Dt^X!pMiFXx<e):D΍>{/B&0,g],FONu#EQ"jADԃjx!9CeA!gN8 @uX3TEeDpZplҠ0m<'Nݢ{a2խ{roPtve9? 3/ԭs3ݽ4FN8~Ԩi>>x;މ w?c̘d(O w$xᣒQ0ݴ[p)Qi99kXr P\e>JtAk9fR)ĆCJmf)YpO (qmC+vu+L3E!od_1Zίb=5FyȡOֹnT7=wo8٢1JL`4Eu\)dtL1o{*% cAJAii]( b."- 1% JƃJʙt ILxy9So^EaK̘-?]j ,8>0r3JK^}yRnӪW7g=bՏZ=yPjggS%H/uU+wfߓNy=i:l'}jڻJy:c;qpu6j2af6FA "WJ#x|j꥗_nF{&+AcqYB΄DMN#*#H#HGl9X9v!B4]p =ͦa|(tD.h`Sc]G%@2$+ ܂A+W۷Z$l6|~c,;vTO3.R@Xךzf{"l,a p+O _q!6x ¢Q VY *#E %TLh_~Wo껯ܸthrSԔ1xNI6Of2bUc2[K": ƎBD1 h)5tt3LJT3pcz~⋯Ƚtb{"ΤMd3Ipu~++p:N糛#3\t]Al)-3"DX\*E/NX))< N1 9jpKpR/"rJ, n*N)eK<5<Կ{H%*05>BAƉ]Q\w"ESڤ4B BH%"-cc؁` ئ> 6㍯ݵٙ=fٹvfgOi;R)*OYFzz}7]nA;m1݉ƛktn4}q4߽҅`WK/}8Zo9k?in?aowWw6z1~Z;%SQ$qdZV`wڜan.}%)[B_U |H 09difD@ep)pgaB%gTf`kC EA_!Q<BKy:5tXi ;w wB48ƩvaZ]5_6#W/Q8mlV8D5<;salɫlwi;jg{꿪S]xJ۳}unaAX^37KN z[ǧv˹vnsrB(R~q> ҂91`^azm Zv_7ɼxfxd\7J 6;zأ^ )>2 PMAz5Ay %pPXN"a|(%Dmx&H|o  [#TR1;_*JEy(j 0\@/"E@\ TlrP.|_Pb `e@xyJEר^T"ܕQ BrU;\{P)1KaZDw+K盥Y^v Vj[fV0^YpT8?'Ӿ47SpY̤^sX6/HJAq7XJʹ)6JةsRs,?}O0}µg 6$m^k̋H_p# b ټ^gOIݳ9H5DI̿6*BiEq8 gզwhwM7N&9lII8c=qMY-BVxo++=Y3|gbO.?9~:P/~R3~[QgþѮs|-{cϮz~>|oH0F*Eag>gC4̒r0V# u3Q8ħ^錔tFA:a}$ quV D$Nk40ƸV L΃p|>87?0S,x&bݲ r@V̧!/AbA7H~d6R H(p[--- P|Q޸U&}B%gIŀG%ǹÄnb*r28[jHgb> Q9Dp$K +Kإlt}t3)2XS%x^KW YBrf ږ16 *Mm4.#+qi&2ЖFZ?P/ӯl'<#-bSY/>7_5f`#鼗};<[qSsȣs;߿b- N5'3Af@^$N)oհy2run൘?뿱[CtH {"Gd{u>1މ,FfE"n:?zumH_`FBVul+9"*,juݞ9QyN-9޸OLՍ pT5wB0託OFU2.Bv&z?tƷk_-cqd|/>uw}>osc'3ݘh#n^r혺]hz?y;AظtFAN++F̯,`"+d3IF6ҷי<L]T1;Ev+g!;Vaӓ."A1^fx h lj*'$ן:sNV l`lMSՐ%|EH) 0 md-8'Y@SulKZԪV+hHV9pM GsS;jLL8),%i2!GV BY?#Wu+r3ls(m|w8е5[UEb1Yo4l*v-vЗ6ylF|/q[gM{|"hMO &La3u=n;^zͩk;XA=an#FBqG,#r) wPOQل2r4Ļ(K0&cxJ@kYBKVpQDWK+P8 e2RRXdT)?}*RL;#dKT Y"X(htvl3w#)\Vas2 \<p伆|>'dPɳt]e0bt]4ղs .̚Jsuiki=8|.(ni ziT\^đƆل.2=_)ϯKkpu 9zy򿄻'!0M`R.fF]Y za3ߖ?jMx&:]++Y m _屎y< =eSZ-hl nbqp'2d֦mBK3`Llaz0S`2Vn4PɅ]2>u$QC"c_o^$˓qhD/l'"=F[o3If M sppM''c-IKW8hMN]oM\g_t>HiN'LI  LĄj3RM/ 66lK$bI+iwZiڋV/$MYt&9s>{Ѭ~x黏7=!O=#<-?֭[+Wor9n%z"?0cCY|8æ].jN8VzG H~Hg Hf-#x4 ƒNPtyq(~d UdFT𰀓"HThŒ S0p&cI5UeE%&(UN< <~B:\{}fl #ޢPATFz(1'`<:)1BREZFd^B{Fy">aXAd۰$8/Fh1fh"M{'g+#z#׎Nԝ~rzoWCY_o:n̼'zZ2?+OtūovǾ;G̵w|Ɠ3-g5[j5GU*IY=u Kim1eTf)-ѤN"Ƞ.E0-W~1cK<+&Y(^p+,qlP*]|>Rz>\. |i RP~xsiK}M1z<<_kVHǬ}tVEq25e}R!YjkqØDD ꆊe>Q+ױjYYY+ Q P/-YTZ@,oV7юvjIb"GqwelM,6x%`k>:]I|sda.MrfFd k,T 7DGnTqSu]2"7bKEJxY;9xw|3LCC4MSѮըSn*'i DcvQ1YeVEfCT2ΨR:)51T2)Բ *״h u~{˖-[^vDFr饜t!.,<$KdQrbh D\]B:E`35*, f.kHy2Jr2t:U b3*%뙿kk]^3*z BY ظi&̏ꔡe1`d/ỏ83`ŋ#Ƙu^C[Z3VA7KіK#wR^+اņAZ'ʢ !ռ)\ir7;!a$2"5Vf׿`^8`|?Nfop8js;'ڽnBx#=1egbq{Pa؅5?tOZe R_*5ݗnmJKl*\6A4ɢ$@JKrǞm|c3N>lOoG:q-#Mkv|s{ۮ3o{n_u:` ^I< MkSQtd㻞Ƥsi 9֒+/wu&lɅ;281f4LpqٴQi(bC5!?M1' UIM"+&U4yLCZ/$WE*Ń.P2'%#16yQl*-|ᑽ{:ܛ$cMŢR%?4+#BCBV`&枑^T#Ç# % HSx$9.űimh.<0;-pIA!x$vbXBnwϬH0{w6ie~596l/0矅UzZ~:\C[}\?{znfRϞi=>pnOܽח^]hkXje^e3jVQ ꂮtu&g Y-g:6M2!<)FybҊǒ,9nϕy6)T=)RV@k|@RrVJit gNd4Ne cVl-9Obk/Y.jkn-Փ2Lg\/"P-P+d+Gw9WM`2ErU 3Q|wjTJXkbC(*0{frp? K lܕaf>QҺPB_Sme">p'z,gR@+Ͱ?n7 mCQ)zM>p@ _}^qw6Ŧ+F_!.7k;;O`?4vOF_v' A_k|~Z8IK@kEjiN G [۷G~rT8I3JƐ-Xcur rH sA7AQdfc`>BB@R)P HڊjQa5KeE\~+V2c 8Q!SXwd5: bv}k+0[1gڶ;o66ٳ=ï}fops|dYODZǷ9Kyl׈;=kğ>8 GSo8^#Kjq( E楈O$ZRR .c=v B=$}HaXoҋ!O[gٸxt|jnBZaiٹo~ [!2T^ ]@NKk5]+< )@TF @uI j˰RDMHCBQ@݆}"7Q4aXou'I%3^7e٘=-EʋHSv3fCAºkAhw*E V~ ( ϫGs hcT$sB9p(NYgbc LtzƟ]άv6h. 3}6ꚏI$rqےBķ_W CӜg#7"?Bb La+20f827|]8Hbǣ Ih 5 D "#"Z`ej\o/o/m|?|<'u3Aceg|tJPNUQH|Veպ*f3"ҵ*d3+]bV"A>_w,C' `WVNA=+rmW: b>]B :5T!_ʕQBB)Fg %42b{P]FrX)Cg1 FM 5luXc.)Ec0r,xY]5]kj}÷J6f(5ͷoUTKjb֭vcGP.c s u[F3:]PwgȰfU!ml5xl% dxT,NROMIs !|*;W][W>}tN{ra}_}͟5kno24v酾[k5WSH*U S$.R䠏 f 1j2.+F6@m#Kmpp>plPI'@ɔHjo೜J`s:Vd,PA,A@`J1_犹l1]* x'1wt~:(,'άIh"l"o{Ι/[{S|,"X1.B5Dv5F H;' ٠|^ö-R(i8S兝DJHC_Us+:Ic5޾rm!\sb'i+` zWc*J.CAB=ZH<o"[Im;g7Wa~_tZ؆*5֟0p,3$`(1v E&+]W3 p-F%1Tu(:R#~joXH@5Ŀw3`+طk:y=u7vn~~ \Q9אXNbͷ:˃TWM `A, e(s4:C.i"{%!:'NES$5!k.,icvs OVDw***hmh #H}a~1NrhQsvAWb~>jL㽾jt]D0}֏i*`$!9Xgo o+Xp:tixn 1@2+(<>:c b\Y$~%QfeE+QFlPcH|oZZw>y+GTRvogNbQ22xѧO;UJ.&3q+@k1oFBHHn}~@[23j:6#]bxRrD>Q@g-G-S/h, }PZ5PD,7QFs֤B=VNkZ- lkl/s;l5x A^;|FLxђuXR,B̢,d3LMCEirPV[| մ >noػy9--fP2͡b:Sjq- 99TH jWQ7 bS!IxeNd]x\]Qg-RZREꑦT(&q'`.9c0沽>𮽇>fٝkv=]/D"Ag mHWwxgv}>@u{md\N3it_tAsa%.}vlf=ńh=б8Mi:r*_[v/7~Q:-^پUjVx/?^i:vftǪvO4lk2qtywu1 w:fGN0uPT=W;;Ԭh2o41NQ:7Nj:("OR ^VET+$O$L6&WP8Bf<M|$ΓIs6k4M T,+x&N $@1<izxac`۷ a',Ip*5"pwQaN?!)>7 9Q&Kla\f(&HKE0EP!LU`L}{PԭS:]YCΩm{#mAB~y nVZvHOzj/ǺM>VݷW߯Hyrhݖ-wj} *␣c[#n'-c\_Y7ߩ];l PViMOΨh|wᄉfͺ?yihJ h%#{qt wa-Е-"xE*Bq/O%*aXRJŸr d$c;Bd3HVh|C{R !eNvXVYFpl|_CZض?y{ϻ5t@zË́`mOjG-?\>SMtGm;LZg嘢IM1Qzc Xo4`Ct2&y d_0a>7̳~q#њu 􈏲'WN D\, .ĀUjVE{ l hg`Ч9NB]yhlN&'ܼӼ,*9ZiYY^DyTipY4111L ?.'Af~Q)L" @p$ ^߉8r띾=k#BS;NX@k\8-&%.MPs8Yu\hlQ}杷6UP]:Xko֝ܫԫPQpbʮf3"p0\>%\t>ubժU?ങ 9i!'Pb>UȧZqΔ2:TDW,%+%3%( hR\@P +Hk2*Z# eħLiCB'P}/%W+Z @uR.JkL-ifX* \*yFdBƖްOy7]V;10:m8n@mӦCHMb'hCc'>d|Dؕ%[ږӔ,밨"CX.w{D}KKYZ`ggvv1]kx5Y-P <D|^FH3KYt04X;-͜?07?عT=]>Ҁ5F'zm:'/[-4Yo]!cdVO⦛xk]}%AQGA7l1GXZLj KBs +IZ$I6+$xBkMJ\KPIq^%b #Mf D"kYey3u֊aR"D N0".4yϞ[ Y+J8 '`fJ0 9KP X9rEe,G4%X$KT(D>B$Ų<`$ O6\t2ެ7u7\2]h|vO.j~Q˭ct'LGf?onfk&%hWG_m>RY70ZL=A Dd\Mi(ث*,:[V>NdUȣj""dRd&tJfSu`p.SҏɄO2ӆ8OBrEަ N'&3l4 1-&1EZ22YϨ|qv-r+b n SGccƟՏןv^[:}9mtˇA=I0614E2k*ej*5B`xZ6}+F+ZWQgEp~2<_ű^$͞0EYֆqF+P~J\4;+10[kaC ed)(~-BxbtÌsY,|D(XC6"x=s`||ѩȹ}=c޲\zq(}>:jzymG[s肎02^d4Ytzol^;~~β BjF31L 14&ѸY <CIQ|*$E4ȦTV9+h]Zc89/^3F€MKo¾&|TGig&uKoZC;c{߭+?^i✍|-A Ɏǒ[{Nn>}˹vnsrG0|8fOu4.[6nA|7K;"E6p#B\Bװ/fA餘QlI ٌV3 :ӓ|?|,MjnhCZKs)u~e 9s+VV9t-sZJq.Ԁ -եr9Ʈ WE UuZo@B)A(*X \-5cQ~]6[6!j(EkkdEEYif`4{h[Wnݩօk)bp|>A2/A>3Bזϕ D PE4Q\9Ho^`o8԰U X n<=DMSѣR3K1W(*h$9j` !5[2)W+Nb88BEQ"i^ hAbōcFxmʼnHe9e-孲%[ʒ]2EHq!!9g_(j^zi{JzΡ@<| ə!~/0K ͫ>kN*6 ]^Gӊىxˡp7 B3!2$,! Qx&̸{VYQ%zzQqvW]c'E"~&#XIÓgnvxl饆j-wjOڰ@Wq^Ikp5Q=g>8+ dJaյ8,88/*lRţ<8g!}J&$Dޤ()CXh/k:\:)i4zMD,Hފ ̉H@hHhaxBWJf$%pdfH N;uQHn-G}^*!$hy/^ [b7un?kk>6_}dOf[///w-Yz=:.-ݩ\9y墳CϾ<8g=5qƓ+YhV-DO&"JM__awc5o9kѩӿ}o賩Hô3P3?zATȥS9Dt!k֌lKCj#cgDZE@uVIŒ\\j>0*yä50\d57:9pY8ϼ§SriDHE,hhj~=rΪZF&i#A!K RFNa?,Cg",ì2d`QXOO_IaqaUns䶋! PgfJp2i%EmdL͝Ris}cn> :<NO`*]q?spJSG:zz;Q]8PGX@3VUTTwo>h& )^gf,:0Qͫ)VY4L.^ ͜ XzX_/3ydp?|l+!L& I/3; 6!miZZ|4\i e'%8˭UKȁ<.u jz)[*xT[G}B*AUp칄6?v?w=w?o~}"q+qCױ>cc00ҙh>qW槩pXŦIX9Om Y'tpr9uno~kտn}_XTUi JMhۥToiIƆ+{ߏ AZnM5M糩B>UЪP!]<:],s%k/ +ˮF(KF{uvqk&*vqgjs}-$$H{ɝN/P@]Θ,$.PvҋTrTFw{9~Xq=b}Ekׄ1L%MИCDEyIveWEׄ7/  ]D9/U`:u:ĉ1HL /uuǖMB<}H*VPQSB jP6ްx{f1}̝,K(Mڨ}JR3gsN.18Kwފ-('&bӹJqZ,T}oW C=}ؽ<ׇyne5vŵᓑP$$ (Xl1{"\IЩ <n7ޞ>ضPXk8FT8&qY0{20MS<|o':O^qlsoF5 /0=hdct3"`5+i􊃱./I`MP 7ZR~!c$]HsSe+|JTrU- BF,'lNrJ蔚%NR IA-A?YlADUٝ?ٽ7~r̬Ңs8 a(>h/+S)RPXQ ")! ͸ƆB\r|4r$#%hqqrڈpD/,'z"yrgn7ߙ;pbőpg6(Ϗ·6_U`yȍśgg:lm\P_(s3z?jpoysCgFnSKɁɅ4G׽m3K&zJvV>_}{E< }5O˥ZqQ-B0,o"ĖQetD˛e\f\]BQ%ZW:\FecWn]r+ߊZUk6Xi=woGbDb%*un/زew|^r@ftN6tԬ;/3'9٢fhވ@3>4^罴7t< mM|}E{)1ǧb'"|\Q,R4Ls&l Z\[WR^4>I*ɰ W"1+G)IY7126CLw'6?Ocuo?<X?EXe{^ 4c!!baȰ5Y#$ΙsF&_`g=F,`qZG?jw{v|k;Pu`[a{3t#')lY쌎7cwN-vL$t_~[GǦn59cn|IxNdVlcqK~)'K>*I",h`!j&z$IH*nb3d2~oM$P54P43*h^3XuCP:SSdCDh&?_Wۯw_ٻ|kd%3N2đŬm3ݺuk{ UB,jt>Σ<.ӐW gٵZ-"`E+76ƶERPB{Xr Jy rEjP"8-VR"KW7!n֖ ޴ *F߬iFn犥"q/W_Y/ZZr3QPnB-CwĶqq?ZR$0>4Ab$M88Sv䨎bɖ7I#˒b[h%[$&wp69pIQ$Ez(K7rRpR)W銀mam-ի{b:A ΍֓g@j En.5` D$q%j}}> >!2U>BUk7?W0 v1w,G&V ^| uxm+g-@d)p,DZD\@nA if&=]MM]K>NL<~agXgiKXgQ>h[}3 tᣗM.S{`3<s 5:96+iUJ IѲI u%ET "͒²*˚*i Tq&IqJ</2~FkqD3<Dic{@\4…qM -eڱLGɤ/y>!K ?赐Öv`8`gXb1J[4}Ã{?a;Gg.\:6p7b޻ ~u}skE~MYkAs/4{gᭉ&g:ٷͽ/>3JS'Brk}#L-E]w|fr-Mp"Kfz#-CL fڝsc}b"J/djO pW`rrP.]2bf>Bӕ[O59/ӰW֋Rˉ%V7J&I!St1yV˪T>'TcZ΍ ꯸jΗK@qZH6HU?y?1<8lkGH;q :7A\%.T`lDj\mnGgs.ctoDテ*6I*&7Y%q㉸GdW>"Қj& X=zF{u*F6Ŝ6/J/:my7vjv18XavhH _n]L>̴~=/B(w{hݷfF .?pc7ƘlAH'd36z{|xmg;dh:/ެ_:m748n;n_?04yK,ždB#29oB$UUVhQRR4bRBQ!dNaV XDh AfTSGrRkגBQC?)A!O" ˺7eb#,`d,53/O^mW>|Ez-%faVŌ*$=2ӻyv4Yȩ\v}M+E `:zP-JRh+Yb] B]-Zh]J%@5dxR*%ZVݨUHݕVUBf7K؛NĠ/u5v\EWJժVU+l .[nn6! !] @8BALB5dxlg<؞Ev2 GUUZUGy]zٱ~^A^G~B'ȍd :?8, gb'#Gmڴ)Jϑuq d;r녀CcH6K AcϘRH%H+Dkݾ$mj{':3YrO .lSJoon qN{FzHl2:1- ֨Җʮ֫/OPh?8V⌌{@z[,Mϒq2ɲl<SeK`aܗ0}][Nl|;.v^W$.u65;Ib%yjo_=ЍwN=j.s_| =5~_k1}.g9c̴n22&(Z~2ffՌ\JV xDMO *b,UAߩU-h,|i#IZj V,p~ J@Q38IStxR?knڸqʪ )ū 䆩! t06^N_v Ԕ"%!Z<':$.($'9nho  qIEEs& `O=w;^C)Gtg~_7vԁ[:q`ko۝,>xwo5onh:=;Ty`bcwWs҉[Oo04茆ǩ7;sjڡYyjw/qjDAl)kB%m!c-e h..Q!}O[*o&|*o!"\.*:ALՕC|J(~!Ufe50V,K1\Sy^@VWmZ WCeοj!IaTLѵ٥i- ip=_Z?ί FFL˗, d 3NSrBr$E%n>ޕ\cBVNOU:Y+_gșXwRm,8/(\fv{>~cfWC,Ŝ>'2dIuqN8򓲭o+_Ӄ Um4J6d#(lz3f4Җ46n8r7s̰ ڶ;rLwQ+xv_p6h19XBmON!KߚZF y=׼je$ GsyK׭ՔD&:FD_20)Q~UT,XXѠAkS7;ͅEDMQ6 z3+nGK &91P98jFtu(7}95.ļI2$֐UN.CF$WWIL L_*XI5'O\bq'Y1Bn%'$ ܜk?pT{Դx]=Zի p3zC3̪6Bae@HFV&-9ci􍬽G҆~6,8aGs4+iۮi1ez4PRP#%LL\/<|'+138I'KS* pM ZN#'gl|:~i邫  CC~jif2α͛PvFuFʠ{h=qKL%4z/SPGt+w%+jFQbH*'*RL1:55 ƦGK8Ō0s1*4zhc=G m KքU%Tu@ M*o?6LfS2$>DPu{on^us%4 phmie($mٖ 6$/f^O/Cd!f]gm]e O 420eN)4IJfMƮ$؉N8%^cٖ-Kdt}dy%ْfځsѹWm c2@N#Zg3,Bv[瑮7Bn};s46Buv-no@! R@5˜ΡQl`鲫w:_!$P9vT.W4֫%:w᜿vzٳg|lɼ ME :*:PY)oF~.Q16KzM,"G:u*Q*OAB1yTr9  K]']liὕcr! {74Xtµ)εBy'{f̟7ۜMK&k;̽ވ-b4brX-/;F|~/}o<>ݳ<h\|ә˽0>ُ-c! 41cA"E'd"=1gz!8 .1W s!\@F}0 NI*.V'<*'Dmr,Z.Tq!RD Ң'N Aa]iNmf[LѪ . ರN LDfVFc"HBST)..s(DTc.Z&"Rn3k4ppf5 QNBh2r< $[XNP*KBv}Kl&iyV}ZO ĪȐd2$jv-RbPBl'm/(zFnt #Kr֭ GNF1X5,wi ;(xYmwwP]U~;_?T@1s|n3jUdO EU )4tg\tQH&,$!Z;㏯D F"⓷qx;R~<:#sϖ.u6q*_;sWF@wӫojP5>~vU{=_ʋ_ᗫ?:0M{A^ȟWWiNP.lliI͝V~|th!j 6q5p{`qX{J\;;QA_wCOm"I4tNa$?>%JulyD'/[xIp9PP~vl wn.Ţ2f6!UtXI#Dt[ۿ}kj~аzVӥwBv u[0eQ.re^a}ha_`]dbrx"g%{oxTaz78ӎ/R7_]s=ш9?y_xd@OR!q c6fkd;81V.lܭq~\쟟OCF͓ƾfK@kSTő#{u2W@* H&*窤*`@А2QiՈhP WJӰ~֒HZ*VURAE?&ѰkuƉP B9sha `[e`g(. 6ZF-'3I# :j@4v ]F5) 3ҵp iYߦP!]ka$fu[֎zέ0wƱ(nf##Axl'l7.88}=MQ$x16 $@EZYY`d̓ )(C%MTLŧxxĝ@+i u\DPxlxNÿ^eyP$},MEH٧캵bo5_Z")>shÓ\9ܻ=PbU+E}XUÒQWD)6lB.N$X6$9H8966{lo3= HKl?ξuOa>2T'1>PiYYYkdY )[H@x: )Ȥ3':iCr˙dܲL: %f`ZKTBg3R!A lh ]4xU6vnM"JVA!ePJII]vamֿq z$4'N_]]}-M+krzfh?}]:2;J\3غ_N%/_"/^+BQ.R \޺~ ~<:\i8pΕv]ovlNVԩ pC1pi߇kܘTkN~kMOl.=`wI$"GӪKkǿP6_m:ᱛ{G*7uB{F}1oFzkjkw jNqծ'")WIP3~!0MC!l :贴`)Ub !.R1i)^LAZ..%iQJ҄`Q J?DxMIυB)i!EC.ؔ$|JdӅ\XdM/).ʄI*:MpdN%QÆώj92Zȯra1YRs:1-e%1ip{6 K ^\-J腌.%D)m]EkJ^+[ae]@NZF{2QZS, V,e6xV2r~/Dz uO:j psÄ3`v W+"s[*Z|UbjۯU7L2۰z3v Cӟl\]lwX;+]ʛ~3Byqo斯]G?GOjozһw*$:cK#l- Nrhl*)fNC.Ӿ:^A_w>؉uU-ZÝ=r?_ٺϸJ6}h &NHSy!f uFHC݄Q%w VnP܍q:3'h{[[*D&gȘj{nsl50Su OH ҦexE'pH {y?z^h7Ajm&ece.+7{Ti:l;lWެ4lUG /k*/ca' By 1|(Ѓ``(hFtÿF^,3S>OX 2W9aDYMؐ!0E8lKFlN@0H6l@~Tx $aqӉ;&3(EzI~hi_vwjv0p8Q #^#^H&x.螚#1g4 9 R$$BrL&IQ1 $y(Ҿ*M;J+cA%O&hTx 垡 #~3=9iC^9=}VuͧinG53gj }GUϵWԏw_xf_ v(\CC,M$3lT`CĊК@acs#^uY⑥-*"HCa89/OPeD6*B݄0]MwBԩi7C0nR^:  ERB[ T$;!v$g;;ߝ_ȋ8N6iҴU{.I鹗;}>*/}uwoeSۇk:Np|b%Bv",>35qefrȃ#9$ϫOm߾ر#>=#%J"TҨ饜U 2vVm_dTf@ګKej*z5_\]rqe Ir^)W2Pl}kk+e\Vܢkcäi^^+?+Ȣev0f*յ-H#<7ʕªm]Y&;>|͍*77TTUWБ &AUU/ᲭnkZxSx#uP)l DYAFYB[ϸGCŝfSSAr;0 ^H0+t:ujYTqZX7y[ &⬳.1y0S?a&PA11&1ǨcNo?w&Fa)~֯?fZwު]:QE 3 GX(I ZBSm k֋.:[N)3@oRٲ1iHIUp yr$SL2eIKi(4+luD RJFYdRWSh, 8(Q^4iNSiȉ7oۭ-p<8 )GTNpGA#}X 8 V "pDh- @k#&Skp=8kmnTx3Cn,;8Rrcycݕv~*>qzAv?kn3oavz'ku톱@O|suhk~m~cYeY?Ѻ8`uZ&]'n6Z//\;:y½ӿCe\+[{0f&I)8Csx!VNmOp$"&l^JF[)./$粂Ie82L ]wφ[C.e\$~{JY(r-ʪAkb>26"T gA\q%;Yݻ>Zc9DarȒ8T)ʅbqPZ-0 EATY۲4zQM!4>jTˀ(LЩM"ddZ.Bw{E5muB%e|ڑE4L+WPd J\T8I+E+ٛxX)hLc]P [#[7m zvfnC'~pv]v񨧣qwWͯ[.av2c,d[ol?]Ýo?m~x)!),vì9bm8i3|ź{:G+u蟭f/.:RE5|FKw6~(oDK UT{iUVjV]@[(P @KDI . Ionqb'$/~c'%qTꪭR_ZL"[{E\YUQQC9Q4֊&pNa8H[s\-]C.+aMA M_9᧯G5gi>훫?ZU.(?n8d춗hBNVq7ظqckKdR2:gS]=95Ņt0#TEkylu)oj uZhmŕRaT,!-iK 2vt]*/HKJ{zKE|%KKgϭ e i"i#B)={_[`~ b7oF0og/։'Y}azkg^G5/auiG/# ϣ<v(孖a?V{n ̠aU|Aq>롚ɞ6bv9X0lTX)X#"3?ƫ~M%<=mN΄;h6qޛDb5H+SJ?{W6~4:fI*F'#I';aXǃ@W{ 늸;"'8aA:4x  &m=dk}p5a'fUz΅wIFTUNU10cS*:UW=xazrד/t5^}Պ4x{^n6]Ƽ} t\x˅7<j<nS,JIgTUyJe*UY9!(%)%Ҽ"ۨ>'$@r>cՒY"o$^8s ݫG!ɜ 1PZ ~PVtvwK|BZҊ,"ZSM*UDk@5aj )a:mqj( Лʤ`.=Cl8 'q6AfF{cu4q-4'ܜT8fxM"g׵lh#k"NkԳ56gӰoCv{<& ,u^.Vx֖Ӿ uuD*)1qJacCLbl @f1 Ēha IFB03h4Kֳ=>YPv#Sݯ=(Oks.BRv h» :Z7AU]CT\ @_#ݣǶmg6rbK֜:$G8j{9 /0d?Eoݺn<(ri99si|Fg|V/|6U%t!)Sb]*f˨͠v: QΖsR .e.uRRT jYzZLVJjh F13 F5]B T#`CO8v~YzPnЙ_\mdfi\Kr*:^lc#h/ yvA`&AB6_#1p]Y *ԇkrcf~濙GsLUc9y.A@8zZ8TR^%IY##MtG/̽ģ^(l8J2-}wOX$>]5u,tz"xscj'c1GeyFx?]_l:}s22}vkɑ4xvǽGn{oA,-1aD2Ex"DAKNY2C񐙹띶{G\͂ijJC^4N* Mb8ܫ^OYIDxLelRmDkMu-%YQ1JV$P49QtMjߵ{0^7׽$x^ }@bFPXQIȪc;6ojyc ),JᢼXd)$kJ(xMTW+'CqHye6Yde$jZEك FoQ~%սM`:ae޽θkzMͫ>[ִknT8lr4F<Ƿx5].9`XlY gjpE^PA{yty[xp惕HsCS775;'Xo_0 @˾I KTTȕ9T8Bb6b,U*ł&f^)Uuy:](!;ScJٜHz3rzE[h|\.q':l֤Us -& d8"$ Zt\-^|6̤e\-MY>^@^@l*`rHs YZ2\776$Y't'| QSbh-%J1ay@Dz6==iY?qwPr)D1;Iw1X3[[e=;SuSu=߹c͛=_<3^!:z[~9Wqp` W mGM|0b |Yyi):i[–3ƨ@ ;"7:׶Z6}{?ni"N1~>4D/Gn/zw!=6d ],QxNGy@В~GS!uL;Eߧ Lxܧi>:mXˡu0yIH$=r׮e"bANN(֒Դ%d;i/jI$j9B~`/30j2 SY=Uu2hYYJ}qvRR讷(3/}h#! "IU0B/)TNhH56: 1fc.6^llK|]\vvfgvzk{חJշK3U٣3gF3{;̔B>*cيB:,z;GBФxsNdUOjnFz/XNN4u%t2Yu\ϯ::cuvuAx}5[hD]=ERi#rӃ@"c1c ICm)eP/ttTPLHd)Դ:U$Tg?ՄRdmf: #T0l8)=dє|,m#ZkNFomcjTm ULh-StDk5?|c*0h7ugk? ^x㰄J&)5^ۻ;XwsV>!|h],df3%u-2sz+ ]%pu\/Ab,F٭PdlW+ j_,U$jRE\Z///,!fE "r5T ]Sju1VnH++jz\."i 3@zeK ښNo/ K.-t s*Uw5ty+wʢKV+_>VwUIxTp8)VW]\^X9.'1=+OHxH)=a?lj]r4??|riסH9DQ~:#C>=1Vh ZȽ(C0$ $겠)! x⏿zkX۵`t#BR'Zb{]t$L,*ӜeQCuN g&.#|PR UtnS!O,y9B ޤ. >tn`D?%4Jd¶c  THPkBE5n0_< dZ`iI V vnJ2h"Q6AqhVU[P 7lxbZ,g/!j1p} dp 5xW38/k+t(L@KkCB?8 IJu?siZކKo5瀯#~~@Kĝf.ݝأ a*PD9*R$t݈n@]^~\nԍ}|h_hϟqu{}j%2MP4&6MK$IUNȬ:㉴;?KE5!_ }zx3G_{pމlnZ  EjdĄoLF7WySK!'ᔕ_(f,|lh)<WD87W(J (e%O>T>y_\o v|F*lI%t/r!mb.d L -P.355ۨJD(=1r~t1푊v %%7%HU(եr ]| ?QD dȜI0Уrequ\rq_aD;,MY"ۑai&|z 3ŜrR]oQSq`@sqfȜ4/Ͻ8HsO_۴g|zz4ې7amQƏ_a2v? 4l:)pf̯lޓ\jkT;C?:݄5:ߌ8HpS2V,Jr̐2PYhZ&fPRߩ! X1y _ {vc= {boڷOn'5CoGdwrK;d1IM,=t0l3dל<3i t$ 3N3̄QEI?ܸ^rY2-:;VZgPC+gc;ĩDӞG>7 >~=qi;HSO`)үpݒº$@Vi_N}?fc1ȉu43&}؉ޜd ӊ.'wM8Č*x>CZo, CAS nRmݴM^@IiĮ8M%_YER$$KúEY")^H^.'DJ%KQ/g>hv#r@Yo1z +,yOAQYeZWErm3]Su8puUT4RHږjOҁ֦ 0+AEW`sC&g08bjj1a?7A7 i5{X$%*|Q&C)ф,i jc#fauа pp.*4Ӏ#t*ao6%I;ٶ#W,9Rc5DNDgU:%đ 4a7Nf *.)>ɨ n$Sn"6{bwl6y\F%UA)'E$ESM7lp2*(DOb6Xb^pJ"Wb _ʩHP+h`] I%\/mVqѥO +ѡXz>~K.'Pbpe` i) ww=/,vF'^nsOc4=tu1|&ogkx| 94Z^3YI,#0'hم$-"//ȅ/1J) :M*n$$p8CR,š9I8(K3 o޹sDJd d !\*䧽Eri>K@Ns.WdbؓayDʠkh#Ij:8 i%e/hPHBI]Z= ܎vE:^}J_kQ7g;GFӸϙv>L][:hw92K1"Rt_hg"R2C/?qhB;+OxzO6k;k[کoF{Ăt*ѱo*!";G/ton Nl><炕=pllOpKnFoz(Kb9͎G}$뙔wqb癶ԂSq2VŲ*гV,Kb *KTr dG&6栧sSH56t\#9"sca+jA/͵YlR|uch%\)oM0<;Zo#3o"6lUbqmT*m'ZC=(j[ҕ i+PiZ.?m=ڄg2_@IYT>MHdH%^𸞎 3J-T+/C_{mu3ffrİ:ތ)n+x3y᫽鼼?h~f|ᕕK:>iHv8/^džK\m寿쎯=~_ѫӗMtw:F澥نx/C{W Ӽ`S $ i4PCقiAk+5ӧ2IB]T.vTBM9Ȣ t wMs//ö1`; ]>gW~o.cI#/7{VIJ2uE<|kQ"5tmu<^,UiX?1v1v6< (y:k׮Mt\Mj &\c<L;*JpZ<1h VE"pSU! \$ weƄ՘Je!4?9^]mi8ll\H DI,dK BK, ^S'4s5:hCPhu`ph}&h ZɈUkfb9. IJɩqd <,%l|$TL:iQ[%=H(τ8p #JGG Q9R'"PXY!⧣s 1ǞQҬ"rA-DKjF//*7 j3"H*McޕM(ƅKG_;whn}Ȫ4ABF2SĬ4[yuF. WgY%S 9Qs@u@.JHY֐pu Ηː#Q#lTJR&  WWF fTVjhX'4V'w26Q+;۠N[a8o~|%}#ϸ+|q];n|pcIut_hc^M?v;MQJxa>=6fJa]'MW>=ljy'?.\?a8>iңV[ϱś1\s7>5-$!s@"Mq eR$* ĩH˼& 0[ަ2R"1:K`f0)*iNJ҂ԋ[Ue4'Ct6$9NIya2#JgR׮WT%H)A ?jaJ :a$Gq"I$22Z8IZ`хzP@@gA"Z$Ϧ9$zIǚM]8gx2}??:4hmr;-ߛn~w}3ߛ죷;͖^~Q~.tn_ktZb_zwߑ4 ?˭'.Z{lSޱDh%d~OͶˎ[m1e:+7}O_8:y/+gVlw#!"al|u_'ER^eB\"Ĥr2̛bs2`Reѐvݗ=WC1S*uta}r9 vp%(r'iv,2.H`YȮMFT]E+BA SyM.ňl'{.j[(*E T2ެ\,guM5X,UkoB Y,C gKYSKRuc^ˬkzims+K"0-1o7q> hl](IǵV#SȮoV6z [<pTJI&fχ}e=Kw/{9zyZs |u06q*]B}`>F?Տ^~˧:|t9aτ6}_:['4xBK;xr=~^y[z/OotJi}!Zr`^Jo늅٤E>- `0#NguT I¢;|tYlp pml}H(AP8Nn'։/ŎVS%Eɒ-)ho.]K.{pyoR>}iͺ pvvvW\7L//z~sK/mپGOLH@Έ֨d\Fe>t: Yl`҇;MGww5QQ}i"WBԭ}m|$>_{^"/#ǂð9<~ o:߲wtG(wܝ"Hiq(1|kؘ G\T~7aO8/FވR/7&I`qHYf!CaN#6mڄ)HEN9i24XZtA"Z(g RZ3D-+*>? QGT͂xs2"(Pb,c|/x.p<\+))<$E՘Ўq$MR> 癎H0rDPHʁ._WCGDk%-2ehJ&7Qheuڐ`|Ld1mM̪VF;Hz l<$8i6:z\Y!,s1&"D|ɹc6(ee"6<N53bJc#G`\94ʲ"" ˢ/Vh, nO3Tx2X f F #W`Hi09Au5p:%7AJ%EAF}SdL4OG,d!:)gbsz۶ T#k(B|FR:+rP|A^Jż\D.C]TՀjZ+T]PKr ]摱ӠhhKjiV^WJn@t8Qjz  kTHPAڰԠ#T#o7:` nR y%̟.VʫjRYYZK<R+UecJ W)/tT,Ő-ep",Nso., p^Kڼ(M"Ο? 8 gA@6VQX5P7%rd~A,4ʫz-#+Ֆou(˅ᴹqoƇyM\8߄xNĊ[XQV*%% 2ˊPd, H@\-$l:OE]*_ q䁲=$\=_}]_]y"쿾wjv>:k cۯ߲ywkয়w]`>LwgG CU\ Sv<ɬpj9FLQ9,j<}?\wckTo]nf?t9)3Ng|2N֎]oMdg*>iW궴UV}اJV,Zu$V[`rB@$6 $&wCnN;vb׹3Ǟ3v.N_T>}w&FΜOf"dDgD'"ja燘lJIH"^Z&XZ\>Z:os7LȈ~p1@<ܕd¡ʅ#J2 *sDCkp7[Lqr>~8l;6|x~*c 6Fұg ̜3 %!I+k:V9R6Ϗ|sdWqdmik4?{؇hOkWt/>;JG ɽoONAr"ʲ-@ת*:J`\FڄQ$=i&hF KKMN*e8Q U`_sMIdURTbǒQ%r9 )Z,hZC{E,At"AQO , ,biIPD2,ɐ)|IWOs׿J౼,UH8005@ljJѐ lhˆZ4 cHԅZ,-5Dk@uR\_- @VիҲ5/m0\Z&2ВJb\׫PuZ)7j0uY6jRע[pEUy 6,r&LȾ}/]F@u+)\S[9,mtSCu맶Un MQۮZHhm N:U-h5KW*EH׻oTEgw^m}˝QFq _6']oMdgt_Z}vYvWt[iKK/bEYвPHE†[H$6q=xf'o/V}w&VY~gpOw?~֍ƍ*I1`2$<I|؝ɹY\p 3&'BgSq 9̫%^3"T=Qƭvܶms/Gh"./@⁥\n~zA)AتH*I*MUbpV eFy ylOҳÿ^{/[qtghr"<9;Oχѣ{ճ~xl^ԝ9s,(8S)wǖӏKw??{Kc+Lk3vK$yb9<ƛo8=n(/!'YQbQ/%N "d Q KP_zՈٚ(G<; E\^޹L'z"-=%ITTQUd4]fɑbӚ9 E(ŢjҗUȗT-S4ne#mc&uI/H%XG)LxRRj4 NB?'7UK] Sq*-N'G᱑jZJP)dFPgNV9Y9H\ b< V*!$Iݒʀ%Wݻ7˰4Ă).gIFDEX`wJP^XAZ6sj\0͈<Ńyi^,PG&}QM9<0>r9MNr38lȝ[O O&{θ[= _=|}x#+" ŰZ+4Pyzby`|BBQ4i %&ac(̀cgٗ;띹w,wfM6PJ^kZR*:s=^i<_zew2 ~%NF~>wQ[ށwYŬgqAw#Y$B&0UF@B,Qȱ0/85'#v6u~yIxr5˭7\g~lo[xDͬWΰ"&-c6.d DǶyNϭ}SC+N Gy%cgoC! Bsh?LP{lz#iȥYʦ&R -++Ӫ ?2l0(<J:Ģ"QZ YNJ*IIDMajhg]Okoξ=|Wc?֨-1e'#/}ۉ#SGAyg gIkQ"_~V vTD ]6|Jb@kp5ǧx. NiT"QshK(!T(ɐre ddN+9r)U`gyXD:gqS_r+xgfDBkFC1t\)<ަX|.<45$9y0ˡKjHs jضm;g҇#ƇtnmLfd zqŽD 1akz~({i:) .s/&m 8A;M2,QN*b$#*h&<'?r2@QcVS s?!3p&Bm"1Z`i^YB1O=H"^۰HdbjiR$H_,4?2yg÷ߝfr^~[7BVyZ٬Ī""D^ _Zg*|!+C rJ1Z2].JQ.b R.eKR Hk2$J B[@a_Є\E\ @Z%o@VҜṱ.j`3صnZ k9Mj3Uë(i?ݱcӦM"/<7ske݆ekUXwז[kZZKkbxi/B7%g˰n-C@MMXȭ=9|aFj Q[myU,!線RaUpuV*7?z_?h8>o?c;0ã3{pv=p>W7gK0%)""L |s;^J&~-[LfJXd8<0Or3K5diq@&%IP4F>@אp|{Ca5T3IN :ITDSBz`0uRńwyg9  櫇]fX,1P.ta,3IM [ tFC`+3..MO\r18?ZuoQ?6=sÆ \3HxHOaFʟcctRq{66OC4^d [4^pFdT}Q`fu·'F=5u鞐s O \w3)OT 'I)rE""3ª^N˥juZ-t8LQ4 /Pj|z]X+%(Pre0v9W6jFTvn$eCMgsO۸qFb^9&f8]G^*qke~ 26 lXE.!VzITجUr X̫UvX`Z*Z1[ϣ(P4b6\|^& Fk9Ky}B¿鮷(3jTmJy }} T!s %\&@@Cl `sm)m{ٙݙ^_{7#EUԗttt3gwG;;ev;g{Vg=mqq||s߽g^ٱuWѶO8>W9j? -ɻ{'B{Aӻþ7wL<9Fv~Dp$=[Gy5 h`@*Q%#Dex \V%Iez*h>h:}dRPmMwș)!qyYv'vvtYzv)n{Z !^~[k~85s]͌kg0> :_<=-T|%Q;=gQ.\1OQ(0QCVdN$ÏrCoBDy0ZN>D"Bh.k)A̝qCcG}CÏNw87u!a/–ў@aq?rr1c fS1@38STn6JFBcp 6 R2"|bOGfmf1IH< FS'w~:3OXAFHİs^qbRYHrp,c"+`?{1gAWpbji3nXƆ&,nӓ~ĔktjblgJGuwCG 9~o.mŎ['[IKk!YESbVWr:9.ϧU( QbF_Bcә\&ӖB0W@\qa^拋 .sbii Q/"H/WBBZF5}K+e;PRye ւTAe@)Z3ȴ ޕK6oӳr}]BkajmZhu֌iJm VV^U֫UTP:Zb|Ak_9%cݸQocJU. k" jZ)pXVʥb2 pĽ.=8q9~=A8v/ Px4}qsہ|=ކ]5n:tv F( 1L4ɲg:{鴥l3} 8sxJ=8{6h G4=tOu3\}gzgm>G/MӶonYcKaMD6.u9Ak PL4DojMXT1EEMHBol@j:GbhRu-M\xʦM:u kz0,>!q9 , ,`VVcU ldB P _X$\PŠ +=kڐ6<8pHp"dƚsg#&Ǟnl$".{ m%{K H2"7xRLb")I:: o0"#OT4TU/}!S+woկG&^N '9*Q,3Dsa!gQ, ;MdWWrɧqoOƜ"A ЉwYF"1!3)ګФFd9 ) RrV/Tiwa:˃B5˳z"&$ACp-z^[]Q)\8λlk*1 2*6jQAU/yRJ!QIQՠIFBqcIBShr1.x}k޼^\vvgwR#mJL=ss3̜ϟ9:&; 1]1|ʃ^9@P2@yIPp:44RQS֛$NcТE[A!&sE+l#!?j0lmmݵk(/\@Ŀ Lxرc[l9xr6JH WY2q׿m۶( "HI%^DXeCiHQ$dEJ ]g Kc P$YeY(@P%])b1eS,KEV,ŠR&Ed$rfMƊ+5TBZYjlH W6hTYQ zF3ٿ?J\(@ژEbhnNxfR!gC%X&S.d(NJT 3K.*c2>, X1O-sҡYrq:K=XjȮyLK$/xG,1Ry ,|-Q\1Y]9$Æ*)*:"VUWT^M X*gcvww} ;v\rVmv-ɜefiGщK'KM_j:򽣓c.ӱwfNga95a:5d΋?3u]7~nsm?y[7_杳:ka=kO:mv:x2xyJ}>Þ[ёqKZ_8s/w<MOP`ѥp,FH8 8BJ,d` G 0Ӌ/s{rcqȃ#@8A,ZZ/ό=k6@__ ^z/C#1mǦv CX8b"F9Nxt a?Tv–qer2C'^ {C!E0" 0;\0ۙWG>ñk#7o͎ :ΩGu<53k-|>O0qC3S@_Ŏko7u|x`߽'O xֶ|wL,Hbs_\z̽?[]q_x.rȷn~C?I۠hIˇS#h{m;։;nz}gM?̜{f=h"рo1HqNS@xM/'Llp*В 4Nfp:cd5P$&8h9 OB`A 3\<34KdHFc}߿V00m<:Zf4,LQE2tc##,qDSf}޴k.$Y r ,jC0\zeZ<~Փm[!zԩ{BO޺uɓ'c":::^x۷[V@t]3G|Rgx8U|ð={455S<ɓ;w޽ҧTU 8/D"%wuǶ}y~vcȇ~*B^`)8* /ˈ%EUA\ȓ(l"XLb|R$Rä*#&I-BYE&1I),- ,]DM*ɒkuVuT7tRe0N 4(</ucL&ˇ3,R]_TQuQ@5K.IPxE n UAjzUEyTET(UôY V5!FYPK5$ȳJP@"Ṓ\TSEAEU]"[nԺ ۶Yfj޽{aD<}ƍQ a#"QqHHbb"j!n|pdXbō7Pq_ j Z`E ر!C-իÊϙ3DOOϸ8"V PVV˗/Qka;=ZfͶmP a#"zyy)ʛ7o6PP( R=x Ġ܇V8mڴ۷ovF#p P q|}}[[[Q 0$//boZZǏQb;dffajcI[Uoo/aƍkoo0****99ұ+Wdc|wEzpVQ](nׯ_wttL:5++ 7 !!={ `tttɒ%e]w`|X˫:qj̾V8[n^C7,Wb*%ŪTzJTbJưطsv Pbj ScV1kTao/>NZ .yX;R49`*4+t U+]0Ƙ*fjZʔjnz"{^8KF1gb徲5>>p悒TLsxI摸å K vj5%},lVVd)/If'iSVh2j)*+^|dGɱ]Ueڬui|sN:v"Te)89^YQsr_. 氮*WWyf&cIIF,yY;(7gb#U%:K}|0{m&ASyqo (jO*N4T4 5 FUz]qҔOkJ}UMƆO6dCtlRB_o9!!.^kXoG@IJpp.Ey OV\BSk۸:5UQ_Q7l֯;u*k}|˹m緝_}ӭm}.ftd_h=mOwxiu_@\D^# ߞ_OmY?*lyw]٭VRI;&@L,-@F3# 61ȾOj~woPbϥˑ^p۷=hmy̙3}tD#Ȥ2lP*C_yZtɠL.|4L"^&L.R9XAYwz);RRsѳ=!2NO%OPE|N_WO\5PWr9_wIG܊Φ>m{x:{uVpxz^Yk_#Au.C|/r }}Oya]AgG,N? I'ېV\? o%}t ׁ>wlW\ٳy9h]]_`1KȧLscµxm8>^}6HeP z3.&za6B]ވ*{;xHGY ~wNHL04Z~  d^$IA ]@50'ł7`gKDMJ^b(1vQj7c1 I|CҰE@L0fy fJ6P.-]wd@Bx\AfbJS,KEi:p9KiT,wBiE"U% ،lWpb4;Ӈwà/-&\npgkIx޼9{ntw\,)!#kWh'9$-)`!ڦ NPyJι9ZmKz5!Pf!wd( ,ͽ.`1sқ[qur2ak6b7=FGvՁ{gj#\LrTo _v߼:7oLvţ}tʙ>:{[? 峐|R( %\FpdL:I fs4!@Plx٧ʗƤDStTQA4M11YX:LX&8{p+Ջ:},%'WsN*e{p!:bWnǶ`[WRpt*Uc;)Cˡ ElԩiWkiM\]k6O9ZK¤qn`,1L9iAa\zi7$uxș64twQ86Y+?u]|_OZqB\NS,X7?7-7|e4qsIUmY˗Le>&&G/*sz˿FB S(jbm Dvs* 11{|vp k4Gn.meىCd Uw_g6(WRw-.%lZK $ّDost޳&e^oZ% A8A %ƶ[v_t9o9µXnĞyR%Ű:g֓KH]>ps㐓 HfrAvEd TBQ.5JC,JŨT Ud"Rƀ 4RT %pa+IAu#69x3 8EvHLmE\~.}'d0HC߳C @޵K[Yg} uۡ={]uW2%^»2bS;$k yjos {H]nJ-Y%K5,SGdh&єIQn<LrTyGxh=1}q0ݽ'[xQ"5"/`^ V m5- Asb==0X;?хc),"ftR:r|]_-.d}˖l57fVR!lpmZ35uC˫C9x_]{??>peؒYb̉G\r (fA*6u]o= i]0 LrSnl4ä* *Wu!`:ѱad؞eΣ ҃K=tb:MQW yGx>=dHK/wFE]G~o T_ Fti':]S۷oټiM>-?-of[Ͷ5[~Y{^rA|H鉛.O_Dhd6@S$ǻX9Ti>y䷱οfzNaS$lOLOwBgNA$w41c*Qκ̝$=;R/kjBGsr[wuiX6O?r aT fR}`=<ւQQquOmh;?ݙq4ֲ}uA vP1rYnŀvu]340P($jɆZ$"eAL|p\0NTWlE5d *BX H\ <`m?$9H KwPKwoځ2JonH_Pt`(Ow 06 $Nepu Yunŵ,w`Tm9M<Lmlܠֿߣ\cN`cY1ϷdHZmMꑜx)4ӇqnX&3s9\@s7rbkF>!/%COنԔ,݌dՌpoC,z:8^hL7bwy$XEI\!vt!e--7bCظĝJ+vzI0`]:]]JN#bӑ%q1;d Ӈ2sG2$~X6t.bg[jbaqBZt&/ig 44d\6 "|_b7X,i-+iҮV{=g"}- ٙspfρ\M3}pA)hym+D2mNCK1'Tɪ5RKDZYUW|ctEgGvܠAt˫^Q =B8Km գwr~sa7R7&3gkmi ^/ߚEJ?=+ǘ\XF s+YC%ow0 /v'ivd*$u";6 kɰ͉Z+pЙaڻ-Hq uVEh=y;/>z_If.g2Zh4I&)(.j -UhN2'|(ve` {R>5iQҮVZ qJ5eByQ^l5Oެٓs' ^D8\j*D&.JƉwّ?ït@!Z;zQ>8дǶ<&@@۵hN5 4&X lX&0Mel =h6j 6@np!o&tAvu$oGeM@v5w*l13\GV#,CX4Sq @Te.ޛO1|+| ؈RCw~RESvO_A JLr|g}*>Fύp%Kp5̆t,P1?/jcY5JW?AbG>^oYղ{7iV䕃D*b#yi[C`Ec*_^Ί"J'SUbZތ2M={2o_M;OJM+BVH*IA9Ez 6\"7\kwSɪkEV"DQWAEsOq3}>f%:_%/V>wUy{jz{y!aU G5"ax3 A]&exx :6ep(' ߃ ׎"pA [?t~h]w^Vj0ӞLA۳(cNr8 ޤݱ3š7 5Bm˩93g׻ѳY1\Lj-)RN2h#CD+_ŹQZ;s, bT].V#6CCyQ:TC9%3I.RյbeUPG :_vwLi.!wR7jո0Iݛ`^ p*yӬs Fpo"ދ8 } @ М/"ֱ_ݺKk`×7]@h2m(>9DXSb- u6!hYS]UpUH"oYUD4M4Vc{Ρ}0\0@z0GEtɵAZw<\72!;7\ @ѼЇ=g3wbaivE-kgFYbP⢀b= ћ\zQ'ezERL$fR˶798\ȣG|}4'^CW툲uZ^eM4?g^4d{Cb.q5}1ѾG|T}-u) `d%&4%΄6$ֶJ.ƒx?Z%1U!FSκJ_ 5RсVe*6=a.I1xT3NM-Y?C+e 2'y/MgIR'Q~\"9ʱsrPQMk|PL9ʹk#l͵l+Ƶ\Mk-m|Ck҉[QaPgMДBK˸Cq{'SOqr'yo{_l|{DOޟdD Ɣp)]WIwzi5:x=O>Э g +gjm9KMmE]v`o뮂\_,7ppg. -ٱ@qu2lK%ƄS9-1Umu#[q2UlݶY[S2X? ؗez5'r֓Sqv7 DT* !MH8RЪM@ $IR1_k=ٝ{ BS:~7G^z}#KQ!%[Ϲo7g(VCރ{꾽6a1 TA l&GYp=Һd#\EkUrl4PKH7lpALa܍zt$zaw|m;7nܸsο۾81T+ɛ"!#2/zo[n޸퓏ܼ^W]):>쟫{ر}ޫ<Ǒ_ýꉨ^Oǂ8lWZ"a4TòX넶!i;=-fiخp-P.6CpS[kp9Zp`Ee`&iB5\uh24S O\ WθGKˁBPp ,VfdqSm?No؟h\5硻p}B*cQt=n'Y&`6JVGK@GQ$j5-E.ȉ/g=DI) RE^[7z…tN9^r%>2 q<<0\̣עhHy+}nk6Ovv # XTRD" )YL65ӰLݲQVuKV4I[ղ&lSWt>LT4S1zM*zuI4EVM /X׷\Y?C 9a8Y/IO#$.l mV0U/_ 7bd r0I01 \_[ V{&m>PX($.+ga"01 >B@$6ͨ!Ҁ{oMش⣯~<63t "1-ZLqSiDSVGil P`lӝ\<:=UR)NvYݦr^2q3c6ϙFLsz7[iZ#&m+ܚQXUsʉF8'ŬI[Kzk5S yemYy+fIJd -<@32R#I'8QO‰8=aKmJ -DJUU! URT0@x/kssvٙ=N> |޼yofy!ϭ6=Y;edO;%ep0I1l26{ 9/ah^ 9q0$gӖLx6y8ztGZxa+jE $#m/;^ FA}U(u (矿zkZw[CKwu∓"zHA}OEirrh7+(ލ;6c!$젃v5} j6:`WЩVh&0d'C>\.Vno0j a!b ~ºỈ{2 Bh|a'F9ڎN$G.رpl>хs^̿N=ZuZߒkxAYRP!$ʸnDL3RfZ(Tv*jmRDd*atwok[;v]ٺLY \)ٓnʔh_5TSS +JaA6J'UI32sy Q]P^R$H*T6xˋRr(zv}8N[{rx;':aeL_jz_ApL0Zfg'&[M|[ox[ gM ,sפEWżš)y>)瓒̫IZqYǽx4˒ yMtE-{+] {<4/~7hNf5n;Nr{z)B. oSϝl9:GOѠ3rW ozɆ.m'\\Dy<~u7Q.ѧ^>4̋ ݐd#G4#hm;K.Pp r:0%x?hٓ[TKRKe$9\y|яITEj&k{֊cQx ;Pڅ@m|ut*^lÑ.Xd ~"(LMGG0&d tKt7E:(rN@VNVl=7d4^fBM][Xs`ob`6b!p'aP/P:FM@ނ]QKw0D(/ y@c"HOD?Ù^ G}޺b][u\ E9a?<ȩQɕ) |ak|L\H<j9`Vcwިn5*j^ߩ5+neBYo\gJ&bVҖXVZcPVtBhiQOOh.LqnLt7y9˲?7j C+Jj*ҲT/VUв  Bw@$!!$$ @Bn$L&c{|3u.x&I}Httt||g}y؂eH0pKwN%{ ]+y;g0ܴQF5;ٳDԆ93w_FWr_%z ϣ鿯ǿFޏ{ө{ đ VȼVeJcօa2+e!nyy{k%٬E8]RAh꒕%t:TES-Ow\'d1EӢ^:D'ج 1$˾ldT%= Y XV IU]LzIډlOZo]R r S+o 1؍ߥhbLfnq=7/!C㹮k(L17\΃U SUc:)KRAv3ͼEpn?8x|r=u4!╤Ԋ.ʁ!^"b n% rC| Ώshvy2+f/~'?SlY] }맷.G=Yab?yCs,2Ȃg7?_~nlK2>ia%x+QڏG>H ?ז=ji,D(6ß7>BM3wWG?i; R 6]^a+N^-O07dz \F"zWoJp3~ eZq@("zZw>uhZ%˴6l`X Hw"чDnf7 k/.u$0Bt!}X^^bK!sBlJ yzQH$z!C=g ELpx wϮ&&/3mxCc=͵1#M#~ө_ H#X!5JIV v d'rT.}))!P .c{+ZDU}WSy!_x|hzө{ DViVbhF У$qZԕpkG zj3Ӂ`(,D󙘤S5tt]'eȦôa GӡnZ4씀mij VN` 'FrԻ۪l̀t7 HP3k'~7=v,CA!l+ݦ1 TOlِ'dJ2~&}-]O2D67kHD[s2Ȣr =ΓOLHZ7ٻ7&>|6oڬJ7ʊ]/.Bu$GH` "+R pfS161n8fԝ^[m{/CW7oޛ=ivvF>$顀8:X{xﯣ*rW0w{g w1읛hy;C臅Lo; %{x3z[ͻZ XbeF=6HҒ56\bOQb*62| k2%S>jlhl{/p yfQƶw kz3{{w|USќwO|!goÍ{J9 ˌl|ܡJsEXce~MG(¸R/B8]zXd&>CwFЋ*AEe,$q7uNk|T`z/UPtAd3L7CoҊItAFYd 0 Ԍd}3mb1bQ3ɰS45&9bzi‰8с-8j6/[ %qyE6k5B2{aSH".ˈʙv":11JQt?=&fd-uW-5',-o'~m+/xG?MjѨo>GZ 9LD"gd$<x:Bb*HeL,MH"Jm4;zCY\ŅE d8$xj1R,Dh"HGɥT2JR2<|O-))YH,ҙg_<Xm l#9LDްO,6ZN'S !P,=#; s'i1-WǼYB1W(f 11JcEBMl|G ;krjny:~;i6^v:Ka%Q6WbEΆKѾ"scxHcV%d(84ɔƻGT a]VŠ`փ:?[(:TCAU~0[ ^40;I&I@KkJ8 ʬ 9z5-jw㫀j>𖹙F\kQ BL%Lc|hN:~㌢A +|SUu\oڽ5e+G*AL 6+X.vQBpNM@sUj%DEbb4q*%1>,[Cq5/ :}dd+X*j>O4 Pu`3v>bȔX'DaBz 1Qu,W~VC}T7R |-4cJ~1ku9LRȑk~p xtp{,ww $"xFȾu٫om3M![\OvTL|3{~kVz㺏wn]vkYu{XڲìvV *i:7" H9TmQ\[ixz2`8Cٮ)qtqc]v[ٮS KW:D=pnFĉQ2V %Eh^Ê* y$@ :)Yw O*8q ge2 ~X}a~8I iZ4Z5um/誉ƏB7-cTB!!IJ`B$$c>|vlO_۽;ԯ:=uz>Ov =Iǡ!<}p!T d SF*yF@ .EfxdN F(R-4ܝY!]"1`1K l@xL&߇x罿޺i}+d jOVۇcY nnjO?-v@ի$4LiֽͺWZlѵyֈZ5540tLUtR1fc{؆Ns-}^Lgt]r+fnl96Ȧez9>'0j8[>w ʨV5,ܦWb\6J%W6Bak[eXvPʓ=w{T#! S|.BSԂ$Hl-́ȹc ] >=uͥ*QZ"85V,,iVu`f].E$RQ-%]V -@%EUhRP%^5YǞLD ==az NpfDgxGƺ2Dw@Bc2&5YRB/ ݧ÷Ͷ޷W&).nH+B9-"9z A: )'_Og4r%vncL45!YiZT RbpCi:Һ(0wpa-NS(GT-Q! VkX/%r aM7)BŕIE۔c`gvTͨմKnbKZTb?wZ^HGo۲,,Œ7vqwci7s/Z?, dGv!z`vtMEQG&zcE^CV(S;Zv۟MΓ?5Aﴭᚬ **7ϑl\$]ӓ1P9ox$n I=aًPo<-]^_LOoĮ%p{lrG|z|<HR$| ʎ#BnGI|#4.Q+K%MUo&Y*c+4@g G5(:PkBV2s=2'ҲL sip Y (bOcdbr=6w6~lz0!'aT%VQe#s 1zH3 @sD 8Oc<6M"X.D1 .\=:UPhӷgi4HrmZ{MYm3@:*653:]5riE1Wz|۬[5|;ɀ`xuL-P 6@}?>Ff7Azí:M] kA#nɱ @qϰƴWxfӟ46`U }klϩuZ+a9[1M0/XeWMS #޻g޺W ~z\c% _"EppY$ IBNaBa"V'qyN{,6Ʋh1J1б<2G向<4bKT4˓޺NC*fQd-jIʢʲr5U+ZV@*EVE50("s̩^Sh ~F1BlW~ |-Q``ٶHx#DLJETurOHdxйݭ/{^>rӤVuuS25؄i3r!C:MI3e(IZZ')P%`6Y>$ֵҮާWeYe㿤O?(3};o}?92Ȳ(]ffc"!ЌiQ n-ZX o j +VR 93F9 ӆ;]űo#Uj9(,0IBe%IeL+B6P5pwr;$U e=6#ꋯ JQ^B:: V݊8$pJݘTVӐ輮O*OB[Y=I6RB-"QB -~~x!Tw?{gWD;op դPUTz9yg)ymxeov*65'˝W-h3i++pR`R8|_v[vW[.Ya[gII7.{ 8 _ɗ~gЌ9ƚ =x&?|jo";B W ppWqPBQ:/'#Y 8+ŘhBDp\{a㼽{g/5>ً5x@z5&2`XȹTZxE<"2)GMQRqIYZrPYLPNv6} NRI%A "&G"[ lޅ$P? *!_eZ48,hha"3͐A#e1v;x[ @ * /)M1˺)v˟?3g6\@uPd0lkmNסQSՍl>LAgld- Ri1b[Fb#.9nY_Od|*'p:\|f3-;PHsϪzL Y0F{Bg?j TJhEDQ HeV!r㪡im6 YVIyt%nm@*29~M7*p!L-!UHU)s rT! %TDGuyO#ƪiH=tkwHղ`BF$҄w`B0[xA*Y=EkX!zV&؄N\nŁQƄ^~P릕R^Nc>V5l8GV= RUH~>Y l eD\xDKQBН*u%s@w@o&k$qULz|1rZ@bX:DxKkK&g!>K>eJ&&DhdkܷwK>Sg: (eE(q}ew}swuϋ_bK숉8v Nǃ>n\[OǗWYZ?P"h!f*[r[.M]`R֍*vq^:ph |ՏPD1ώӕ;v8\^yOMjZ` m᤬6p)'tR53l=7?>xp{yPЕ \ ~5-ތf?fű~ ş61IU 9KTuc~K*mhUAM%mBjhPҔaiJh ǎY`l 6^=glϾ}Θ#=C^+ѹ=ս:U0BB@  «<&1Q%ȈHR5S3,H∜s'ȸȆh܍R8 2OM}nNt=7 MCs$° q솠5F@%P_4:q1Ɋq2MLquM!ECH7i)%)i3dzі-ZE4i}`RmT'fZ/A騀yKzb犖KfI9RM Hgm96sFΪ[F!W/Zp[EPJNRJNrŪnLɼ5O59Sr`m͂y -,z 2D N԰E@zzZˍT6MA+]̵i77۩|r.8N٬V}[~xJM5)|{~s{v,u"C׎nS`M҈'fGK/ G,P1 Ix_7^yaO8ڣ{WdVI+1v81=q'Y{powȵx9|>ں{"@8N q|@4dNQ!6+B0IH2 2'H"H),,(0&h Hɠ-d]Lԛ%)g ]2"auYe KV*-k"1pvaAx!ZNUUPO"JlcJ.` >Z0'z#&QjcfPl2MBCQ<=t gW^2<$g_ޓPsLljÑޘ?֣o.GW`tş^™/d؄1L|] zm<.MCjhQ`0 €k J\88$ƹ4۹v~I !!0oDh^JOX-@R1~F@6L즹Q!5).MF* "$q]~FO+5;ig./  U@ > с犿,g N?7W^8_8ګXITύf?+>RQ| Ê,ak(ZN+TT$`k`Z Ga`dar)`tr@RT3Bx0WXMu x?K I\G͞L:F/@*Lc5ivaBMfPx# C Z"D4r`oײ )kC˾Xο\{rF6^6op_/7\o׿K_xڳ017֦2:)y)DƂh=袗i!1~OGYxN?~ .|`4Sw'{)nImnHRCU˥Und!IJ9̻{xOKnNÓ>13|.U$vB! ZΨz;P1mu`fU; #(,Ϙy0䲀M Ho yP;)OcrXM+a3L?(CRp؄u^~:BV`m\6@ ȲM4eżo[Q{tCX!Gx~]Z ME.-P-lYqP,FE>5c\`x7l"yK0 FΉH7q'kf1]92 Sqiύ>bTZh+b)hNA˚il}i:#X^{8qq}g"*2I^JpE'z(li#2d,Ԇ!]$G~a96}_ kx٫!ƥK $|ªtN 5U^mIA5wa[x&_cZB{}_'!d6'ۓ}h;۲n$y0!4r"2ߤ{3cUGM\*E/IVDCJ)1(L`3@;CA .E ix9'O"ove<;j$Yh#}Qasԣӏ47xnrfnzٓOg>~tvbffrtII{罗W .oّpD@GE2.F]k<ǫSx Cu J`1Ri]W }!u"d:1Jl4fgSՉm+Lds6Z01+ dgoΎW"s< !NS- t FH#zD_,FD~s&^|iz]V(_Ͳ)p٪快x?ŮQVqYy\1|Œ5pӭsI6M47]tekHΥ8>oE_xkF igix^_`% 1uv@=P덅?}# I>˗i0a;Z_Z8T>me~8 UtIrNj|>2.~-qPFtHaEf *Yj'viW#\yD #V.-_?@G I xH "湇8Ƽxk=2oI8+aF  QUID`v*m;X*ٰ-۱͢eZ.wl\F>$0q^Htg# ;ȸjhi N](G7&\ RU0BIkN ӤVtAHcIաaɭdCRDV)gH%'ki )e&H+ijPz乴wT6MGህSP=B:谢e͕{.⺂|> -TA]O߀)@kRr#7 kFayya- \+拫+cdLZY~_dKY*$ uO+󙫼1%>EL<,B22/\;}t-wT6$P:^U Yn&k"4W&ENCwNN@oNZ;QLU Bv QL8M@ݍ5^tbE8ELʊ.IIM&]sJ Q,Ai)2"fh%D H5&=ꃔ9(r7[zҒozޚ>,V9q%Vô8D6Rc/`AIgX-BJ Ӹ D6hF"cLg$шoٌF]CU#7~zH#n_P2F1;x!pAȬO S} 22_!\R٢]IDͮpiuQcGyiל斵YYԫƐILp6kϓ*h:྆ޝPiNZ%,{4-RhiA PK*&:Drdu6dn/F-x'4@]B*?Ԟ[~bϴ/͝Gʒ/>OD"$r~:1W$FnD/=ݴi^_+>f}(ݵ #-['KJgڿ .`8 ~&bj*@Ugo5d8鬬NZ'՘AV."ot=:wU'qGڡP1 z!cc3dic7 >H$*Q2g /q`*,DK&)*ϫ !kIc08]1 . 0q$!%"G*.$&и$ɺA:x0Ԥ⼓dWbuI6 Rt]ՒRu\U01& h%ǣ1p yZ ,&B)Kim`mdiD 2~ll>PW6cdJ=Ӻ{K۷{݃l㓱`IϩÇ>_n;5o>5c ,ࡿ/o×vcv^ 4A+pE>!RBu(2OI\mt;"p/닏vQQD]Q  LUSI'٪,+jHF^`-DAAƛ֌r8nG(р Hއ_ZM[SG.&It˦(.eEETT_ -RІKeEŁ_Mwg24$!$&NI!СOS`b7kmc|c[X,ˑ,ɒzvd˒ I˾h*eg}yf~yEɊ&RNIaL4Aqhga(jQHa#q?x wc;:gu=ΞtkcMT-.ckyj&JNS7Xbn$8ܝdom`_@ީ81񆸭6da({.$]=4PE2N!9$FեuS{+B]p,Nޫ $˺Q7p=X⽕?_uҦݶK[g*jꂂakn:ڱK|;#S|ucwV͖ *m_f.a;uGzcZ`h?l8[ ?3{3Fˑߘ.rK6PK7Ź[l#sGwV"Z}r1ovgkz* Qhj▦(5K :Kԑĵ(JRykkZ-Mc>C(4fФ4G$UDe$ Q;oEQYg(!j,, " Y8"H(RTFUU)?C üe[ AC* >P=( t$#=/mVT>dIɯe5(h}h@R"QP6݂xHx8BF<6 4mDiُhn4QCVg3Os٧3dlY:]2rgL懅\V_ R>SQIG~{h1Kg>z$_T~o^ݛ;>T?MNDNj̐R}<3r:MC!q+I\KB$nM:cB/Lp=*t5`.xjΪOS=~-ؒv3+q.|z&=Lu"}4|PMTB p˴MdB$_aZ. 37u<:t5${QXq meBtbj);y ֚n[okإ].W3߲KV,]qͶ~te˖YibVd<`N\ j[Om\W|4P7%;K%6Y}8W%O^%E[5v6}x 2q}/"P%:# 8%^PD->%Pc\~@.yMmӇcv|xA4j qJ8!L*!(\FMJRDGY(7d%KKEU6Gp)"h&,9c%"Wɬ%U*̍6(jr~oGr_ST$6M3i'GL4[fLS`QQX嵗{ I&fwܟ9~?G @N+ glA[YóX `& Fvdde%N!HDPd%;Gum,xѩ Huo.j?;c/!@] R0)et6xzͼyLxʾVtO43ӕUjziY]\2:nsZ({s݅Hr쮢)a~/>4NM,[;;û9n41]z٦撿jO#i>ť)vZHm)ԟ!K|Jy2~h=tݦm˸Tt'rJHr_<ɀ|az g@,V[|_V}HM/:u/Adi/}}R+{[;ON؁N夿rC%:]9'7e=u916NYVE:oEW{>?.P_Q /@'&Zc2ʪ."k@5e!@h#O1 J*J8h:tF3?5%|t"".jX:Cl|R׆RGJS#m ;g(MS62z5ɪ zq.Rxזw輽4iͶs;l^ZWZz/pp`VxTmѐG]RKr2 U)! S3d$D",N]h +O \ N>3Vԅ%! $ 1c]ͥ\fT\gBZVzދɍr7= 𚰯\k !XA{H'R:|}R fJԨt)bl= vG˪G{y_4fT'L+P > !j[C^;}5v{zvmokw>[%svLan\H酫Em4gkc9w4[-r3:b m#,H`i5}6`X7G#4ĴƻOL=rr?Rs ҎN(,<;'%tPCͬZ4a0\,5`JI.pRLd"H3<3F<.UWY^5*Ka 2?S>.H:Ye*?Ru^(zSb-S W~- g<$6uCK[@[F2+@ZgI7 +JAp5쎂i_z;>__^86T#IW¸XLt3gњz/$[杶h6;Pvqq.@4ꐪZzyzRf5&O> m%m%%g⫞o}dsÃx~F5bvW]ߵo|| gz.lm aae^D!}LtJcMb*6b&%d8 OE|c:K9eB^[tj.!9#ic*S=S^Iex6mS:ᓻ{kxtҟ'(Sf)<_ ?k:ڱa|WeS-u =2鷳 nVOtħ;{G+sm7Ol7TxU"+g@lHI":FYi)CQ5FvxG`3BlpQud`ݔhaޞ?iӴ)$Ba CԤ@ m va|ǀ,|mYے%[–j/&9ؤite&ه=gg$%㲣k9ƙvdJ Kl:VJ$-H0u/G6o2hszr~O꼽6|/+<%*x{ C8է1Hq5WevI#L"(B;ɲ8Җ^,1*F}T0)s^S/IcD݋)1yycF4#1[i(M)F@\ƾŗil!)㦆sGd`|-iۦ_~r+VQsLaVp+#W򵇡譣[sc"ʡ[]rKt66|5㫁} 44~Ub:<} TdDXGc =9C&<<4Ưc?>F䥦/rh2|>;yxeNu^0U!$_/嚏'|POuR-Th={6;I߅?]!n@ y/Ija*Iia 7!ћ?L>Q% @4 lǞ.u]dXb$0PGۼuBu΃mHK(2kF T1.B2s4><Щoҹ m|a?x hVXrK4>Ŋ˔XKqjZ͢i؆! EMw\2 ]c۬TI0%}C1JAuuyiM.ɪ͂m; ͡Ui sUW_uá#~{c$`Y0L)bL\=X먈)4x1ӄ$-~adeAeQ~Z489D] 2Z~t3YS> =tw+'&gKn`]?kؽvώ#v{,];wdH!eMRgW#ohQY5F0~"S@cV ̖ܼ+zs2=&F*ߊ㜔1X+6֏\مOzTai7yvJGgBWUw=}Bjhc` 4+? ` kPEkOOc>Dڋo<0[۾wkV]"h(@4ed3@&Q'<+] UQHNJhJm9-΀-A.nцR?z1ۋP}\4Y1/ι=wb+bsI >vj1+ҺKvЩ>|p>A 5YICbβ-}oJbc.Ƚ|iDCP-K5m7eD#чD%Y_#Uhn;سf&qY,Px+c廅ԷTDjMf6#OPl^Zl-#B?Mt|s;o;n?vԬ,nav*%u^ k@Mղi]b_Rدߨ3/}V %ZHZQ41G6` p <`:xaݞųٳ޹s}cAm^!oOGs>~_lcxj@HcYD P"K۶PmW 5<÷N]UjݐtL+u(n3S܉h;ZؽsoYY6EYV4S!X ), ('6B1 N.0yVD@AFEEaϰrRL~_z =lY ?E!p*Vd? 8%;l։C$BC !'d !뼶_Քy]YoDZ\Q rffXƶF )F\?7-->kFQ5։^l k/-+Y1DkdUMLΜ;#,Z?xpxkOwql{x Ͳ1٪=;ǚ+OH1,QEI(?݂4[jnE^*}7%D;HnƄTZNeGOCtُܞKl\s"zx:h٭߷ٷno[tWqb~,OZn/hJ:$+ jj*[aVMSM< d T;9YF.&M19<?Cbmwo:ooMXI-?%e`RFx#) J_tYxp1"ȥK{9`?}&<{"l q'sO,t#&iU:IQ_`d'q:qFF`ŭmӞCX}y}Rl6z_T q5d WӼ ,⁦t!˷af9C$5̲8qܬ*``^Kk/ϑKq^}Žx-Z`i?ӺW*Z6E㹤XT+בr8DF`-?MJ8`s}$YS4 `5hԽzHK,3c6!:9s{'QbKkz޷_H`K.=`yn'/>0YduQ)X )5N:jA<m:>ămXOe^wy[DžvLo?!+&c#[#YM3x]Ys֧RD/;1ֿ>ݗN$dJ*"05UU5Qy5 ".rf<4lҜ 00EtAą#PΎ1`C8dҙ$(ąz౟ӭ9hMuA8w7k>I ''4 ]ЗYԍRἊ -(֐WżVu6nXZEY/ $uӴ\]4{+L0W5k1W,\8QMdXPJsM֜{ө ֥ҷgsg?&O&̷͑;'{, _Pc3؅Xb&GxÉHGu1qUn35>H c;K{K֫2L՝ml_<`VW̤t.pO+?;^r[ڏoig}bsW}L'IHɄBgsG܇8|ȱ-[dˑ%Y,]I{i!Y`HJ72yfgv~̉5O:-ZBՑc\zA)`"k3?_Кy̏މИ3q2]u_bN"(&PLѡ<ŔT5##},b QSsl=N>mLv8|<f18b@lsR Q|$WJ0@]1FD;WJ*/QPZ‹yɘ`qJapzrDG&ؐ\t,g㜵jL܇ N _0zm𲬼.zel7Wo_^QFY^-_o޼ô EI+)z 9C]LM7N٪;|6|,^C]uYma- Ϫ20d^ Y1d?$i,4U a Ï|f^LXnE萐 I߄oZ>VmGci+*'$/pՂ\PP!6DKZb׾/.s0ͩV01i?eY gD!H9>ȉ A1DRNlBm1BpC $2gDZDw&3ɎfHr8ufh|sQ"FdTlLQhZb8]V S:rq)2yx,ԑ>} .-/b,oKĤuj[__'?]'\GDĕΚ j$$Z N[OO.-t#U/5\ZʙA"dTZ15;IQQ >|E2 YȰ 2dQcq1"\:|hd 7W.\;4WӐwK}8!Ъ KE,&QԚah?j<#(U1|? 2)bl@T͐1)SDSQ kSPwq;vޙ>{;a&|c]nLrY=-`b66Eĕ@mx>aUDq&bѼe[𥘤hYN5S5FRPbbM1~=Gqq䤊rʉbaMƒ B c2F:ЉEI^iuZεs^]Id-E=LKTt~u1e!˚tG\یK-rKJ6`$Եe Ч>BX)pr'LKj-$8.OãA3I(AZ䐚B*i2#ϥ3D2Y1n^mlfrf*\No$s]R/3^f7__Z%Yd%e#W+pCT/7Ϋ"lY,B h@*S!exhd,E*!nAomx#<#6<:'{o7hQxJ9ǻ+Cw] 75ݾA@aĵAQywm 8`_/TcEsC [.bk\Bk_=J"乇BlZH,}©PF,~Ї=cޣ;vSY.<4[oĦ 3KeF+GWFxj5va >+.*WYŏVھ/=\pqWg~X_Ο#DOq$fLFfdNJlg{CMom޹7kgAwc싒 Sѝ袡 ZZ}8ogu{mb#߂8^jBz/r/a sZ?"7GQWB3(FI6ɠmH%_όWD CC8@r 3#( *4r\$xy1u9ʃfXwz]8O9~V)%KOKX:( tsD#vU#\rCIlmײDZSHU?֍L_8e ؛kɍnK;Hf2vne:Һ]M$DBU_̖a#?@3%3u[,}^d,=[ #3yNE'B\Yl0(EWmq"⿅N]~:hPdP`JƏ?qˆ2z~yv*# ^&/%XY}m8k=rvYm:P JK>9;?"́CC^C Ѵݍce(qo"JnEGѲ(oQ4t?äg1} }0ڡ_gMdW?A I !d؇- %C f0` C1.ƛMjY-ZzofQ"!oST[ýO!6 $ 0E;£apL1TYuERل;y B0M=!7EET(q>ChąVucC`>(6*ڗh}H[틓DGeD\M,-(zҺ9ͤ@Qav/0ZP6CuQe==19~3)YZ7zhߑ?uU\vi_3f29cygugeo%1;X-- K+eJ Q)&9VjY1cj?>ˋSnk,8eK :5ggoz5fV,x[$Uz5W8[ Ԋ5n/򻭿}tL9ӽ7v "a9C?Zټ]gKq`Yh7}].:oaA?$8RFYf٪DC"+ƄNkqaKsgBH7;ЋMmuC]i"iA7e)lIbxw4}{`Ybz8D{S9NF{  84O[- `pBx.'"/Ϋ`[>HJ1AӌQSzlNs&7'^ua4$EA4.J2zu6Җ ۮE\EH.i͇jυ x@SqW0w hOTF{עd}ub. Q.hwհɲ7~Ç1M`JʅvCh0ED)ƅ3(;cPm[>r8FU ʨ,j笸-xP'Nc;hh#dMu7 (U%N X ah"#,=щw| νOLw#=Q;6 Ff)b69IƒP;詋{*-`g8  x %⢜dC45D|P. IUdM3TtCUٙq|39YZ{9vu<>;Tpx{2F ĀLX̐Oc"2325xD )sUZ4VEUMX]$Lƥ,鞊1C ({bQFhX1/_woKTw'W޾Jϕ~U9_.{y(!Ko/)J.'k"Cw3V8NuG,>[ϧ:P<Ͽ@-!2F܄QHhtJXTkBo%]2yLWx=68IK>;:XQ(H` ^ӝi?wAa02sZ|]H$Lg%Uţ`?ف ]omr#YzK (_+ eRJ~t0w4ec!I&)dY@!-צuMג|NTTS*DB9҃<~KpL&!pB5-d`f : tf1d po64L&4m.2)T-A'6@k xጴ6ficB]v;k" DZۚBևq8"]bK޹" )fA"^$-&51alˎGޮz[r/LCtF\ôMNS fhLQW0[fՑ,b$P3h*jx894]IU_v@csm-ߪ]cg?S;aDsܽ,8FQ$s;xl^`?{`lc[Ks- {ouoA~ N!ڎᗕ5S]Go-gĊ/OOo8~t~10jRVx|>F}ʙ8$ɢ!+::Od!UANHV]y$Jƭ*q;9`D5")>EiOE42"vMwCJVq(׹cΚJ8֩R{eumFǖpi7\zdB IF $$d9Iξ/9kNv@*=~ ,bm^@[P3uQolJu]xWg+9JXJ+Һnk%_r9%rE1WPr*.ϰSݸ}HLƂ6n5{BA~ }vmls¡!bPM HBdEa*A:GA|N!7n*#d^wJL|=&CWJg9$^ÍskmA-?f,߬vD,~J˙ eX4b  LZ(21)C䔛Ibu>Xk:؝O9@b!hډ >BbRb 9eQ܆bf1<9A&<o{z7B1'/BD("At8/5EA,AD:SK/>;N kd|zəIJ %2A(IḶ= yvryyt%TsThvQ,`z)W?4`'5< ^64.uC])C0ͼۍ};ز~4$M#8ȖS *fiB2§bKGvYl$qL[ .Lb÷'wM2xjD.o PQFA'G.=譣/]m_/!gs(0p9ֺH+ ؈IWx꒠lB+ . lb-GMq(5hY%[bQʌs<f3=n>طuキ&uZ78#ښVԙR8!Ur$ٟ&{v1vaF0fc:A: ;-t&qiLxZ0%QT{Cs&Vfuu U(F|HSR4obZd1# 8$mUS2[^  v#'2e$[NŤ\|B.zm*/#2^Zc R+֤F*Z}Ubvijj]ʵF-Wꮮju=o/7XMfeu`V)H,S\/L]fa'۰'\6 f F =vyfh<= "xV@4D{ ]B3@4O߂ՁN=OH߼P_[('*Vyhd $5&ºIIajAֿkeˍǗGo[>4֞Y 7}G%=6]*Rm#.( "iυ4B(QiXϦb(ٴb8rᐤbx.t^*59*ՖK&{ƈۈdf 3 ý3;ƍw(7Q dߌTi=6ZEsh6@K]PO, PSȂ[b򃒚U'Wˤ=uac$';#~_>Tup j+zHW>wu_@DZTtj(Mm=95/Ϊ]4|/}|EsF%~ﯚ;NUgMfgDM,^NBmӀc0AEc\IOUYoPkW/|;b%`qYiC:r(gtW6cw7G#?UYϪ{q+XꐥI Ӣ9!C\HXIWnOSQFJxMpI8!)$E]ac7dykb[0ƟY7V}e/&"TJ<Na!*{TjQ``|:~ۅ?98nl8-|$ J<> _pj(CpE֞]6O' A=02Ӌkoec3'c0oʺci<ոI98&f,nOPOe|4ϹtO!cr%,KhDd |ȥL&ޡ ^rgWcw"H1PjGo=ǗR˕J,K;v>^e!Uri=2>_Tg\F`Y&9>Jݓb]WQm'Zn9 #M*#r%hC>SB #A0jH׭tv HHňI HDsgFEFW՞JO@3Foޫ$H&(AIq0 Balધ󬣣rK.ĂTLAsom8H3 dAgOn6jn0 rmD>|%KdͲ \wj~:}uF*bRFi*cG~@5_lS؀hT3l$b̋Rܤ(?M86#AUb M֟ku/댆Pԛª+sw,Hy`۫GkBw.yoc2A]6uܢ12AG3 *F.-T@ʹxh Z|\rӕ$p\c.v2yi?tŇG/GM[(m). @Yͳ Sk7˔{vT$C9<H#-;1.\Hd2T@olmj9%xr kl0eBTcŋnV4e=};"+$!:-o*W>!4uoXRk?Sg"?*٨ebx&DE xbK@DAϞ{{n' vs}~ߪ}V¶aZ?j5\nҳOWǶϴխD0tDh}C39`~p_M`qKز]{{1`35S۴7F[7,GY1qk*ZѤH4fA.Iw.hy4b0Hf(XNbheD9{=Bߘ֛ƽk>v>aauGvѴd#83LL&3Ϣ! Qqwɱp !prMޟ_&I #p7mqj.=]h$EΣ Fdg Y/DV `ngI]UC/ޢ T|/|j*F,'[Fs2sGX&~ Z^(WjS$ǃr.qL+RJDDD*RZTJEP/4YӒŸrLVd[o]yYЩ UV#ah-٨|b)0P<0swzZ;OOGG.@VC:9 cO>"# ~kmq}sd 0w' z0eOWYƚ'~4~[M{GgG=' hgj/nL@u\I{:{N;ۆ\v.#)?>gjڷdMͼ_Y'ᤇ:'umo5 ni|"l7"q}gهka`IH'BǵP|1>pکTJ/ ؈ WVyQMAe/N;q7~}ɳΐG}$(0'5"Y$W-[RqqB>)\qT"s1ˏh g]1T1 ofqXmJ.tϻ/Hm$z<7ECg8L{/c2Ru~艓>aC&*rBƥT /&%$H#ut~q`Ind DT@ŝluV/g9#gxJu=ӵLN Rt#Cvfkc3ḑNb(SyK. .v;zå3!'$3]x;L,bWM'R j,b)ϗ5^HO_ihKO - \;5;’c|!&ۡ'M}֯׮5}^w䞙;5˩u2h{7wӹޟzXASw5>V|-YՕ)sJP u fcrfᜲ6xcMW{Gs L r䋿Fkw \?rhVނTi}si qKp-oO 1a3r7` ]7\ X#dʶ4aO]4B^w~jT$:YቖRO:׬=:^D;zIyIC DK{,-9F1kd[Cv铥ףvtBs9Pv+'- -swCa#UE@4s8P[A*Ȕ\]",E$EXo{ɇ KٿW鹽5Ӂ0:nB#ɗ\QĤ` hľ (x?<;QXcplg)fK>;OZNG(ĕьR0lO"wB -Y"[`t5.A% +χQ4Yr9XעzO̶-+ds:!E5 ՊbX5߮Pmm9"W*bxe+Ra;S,KҶ^Kg"S>oll>@k&LQ]VzIA%LK'9]fbfFLGn+i5KL*{T -gæno9+Z )lL~8&Bsb? X)x,>ĻFTl"\u5ivu@J=Y$2eN1C'-MƗ-MoG`yzYGӆM4,ZlWP}v?,)$0owge <ۇt_<9:r琹~b[ ;O#qv_s!k]mr^z3t4yΗn]h?d= qSX>c֊vJI_CFDLJ~uG9gaxP'Q` sLc!e6) ̗F !F<[hGxޥ]vu'O}:#9X#^c]aNC`1h<8gi\]9m=舼8 BN`4= C\@L$3r:"1.yƲfF9LY'RTR#|d|,>к@ĨRL@sx:T2G[x',^ɧ fS-rb2S`rO. bv]mHK B Dv"~i >$"[ ]HdOփ%ZR–n9ͪ2ƽ"pގj;c/Ȕvz[nGMk^K> &dN'M}8ݯ?NK8ꘇ~iC0L&Vvg6Hm굨%d)%7R }x2 "›{jߕ=#+cT 3 Q^O>h{]0h^H)g(gX3^%x7!% \JM8[KdQ+|s` . p\!.Rd%,Rq/53}Gz- d#<(Jb!>f>x*jaqt2n&c>Gu|j!< @|oNxH4sZqD~5&l4E+(tjɈ%a1(S1I YpKSQ.ᐵH0 LAH;f[h7/oiDj:($Q hDGӬ(*jJR׍o%%Z/;NjTΑJ AwoOFF痀Ǎ>3(fJ\Xvx?;tPɀrN !~ɬo)E!BsI2!#5Fuuĵͻf[Yp Y&noW=Zcs*|~C-A5;u54l3>lYa쥽&f(}nw]s NE^dJOʰYVTTL,2$E} L_7ҝ:0}e_B)s㔳r̡̓~6xdK_4W b8l})Ѻ ≒OQc%hJvwss/n EAήb6zA+G^9m Ϡ|G[Jo~<7q?[NIe-(IXH@= ``` ے*K.[Oޢﻶ'ɢ'ySܦ{S]O_݌S ܼ=iKuv(2 C^KI!<ŽRw4Ճ. P7>mKw]Zl=<?٨ؐJJ.U޴VCc,|̖*i3f]/׬ l`d`rAI0kk]wFЫ,JC6 wj]*nh kj.Ub̊ ΋mbպbXq4 F~uW-St,fY6M*fA嫨<l7X< u 2< NS.z~UrNTdGžS<;D :z̯`Yעdggy2(w_Nؕm#3 Q)"oEOٴģjd|d.NCA$⁑,;۞phɭlHN\FP Za"28| F8r]B3"4f$8<לMeɊdZ&ṢQA`tUU:-8&)?EC\nIyHE,@L LC4'i 0ݙ}@~A<<0@ 9O?9iYOQ M%%")K^wދZTYQl=W98wL\wgc_f $]xE0|#L=~up8V5 D3[ƮvGv-oܷ㉀?}|^ysԬk]h(aV2a= {BR+/w[:xvfӋ>KV$cħO4O~u|`˖ah:ԣ;qh}+z29J!).jzSBN{,{nH8,Oxm=sk烖@hrZS:mv亝qH| ըz96{ xyqL=BHM}w,غ[娌JġՅ s@M+ {vLD!}+hv9 'vo#'Gy] vA"JS:"!yPљ ,Y %c"+,$QWW""&G@14v!>ɳ~s`̮cB/l_yį'u1 bf!l}$3*1y*,rQL*'8c-H-Arcl_Ft0+aSVʔY -!!^0 =H!'gCt&VjrLƴ!k:s-kJTl iǺvI,II2U0_uP3Ef aVr`VZh7jMT7ܹTHљƮԐ*d[,WҺe(fQ5د&3CJN $L mpmiQs2OY$ےm:lyjO-a_2? Qfݙggg}?OdK-ܢW0 3{G|LBAa%{{pv0b<=`j}۟ cPH }0#H\5n-yР xg3 S'g%$2#ű6jl),aZ6_0@M96|Qdă/]Oj/ 7e@R8gMV\>z^RYMKDD1MB5_/N)١5Ҹʦ\Z΋4F%.,#YjALO/ = VDZWYk0#@-<$O+$6#@UΪ8<\Nw\[n EedxBd CM'2ikhE P s>i D q\Ԥ*ں`J3fK2b#f<GF)gν?ơzk :1k  1.r)ruPksU& MW|MOuۦk<y?5|e֞mطo料=Sϫ+riyPO^9w>и{WC%AD@ qy{#?lh =<9w0E'l3+uKMwvEi?6_ gwF_}ex4ƾ~:u䯾s>zo}:/ Лj>w>8>8:' $"I"q붌L!6 T+Gf&HJiui^8w_wm|}M04ɤAA1 n#zlt2G1%ًw!*Jˋ~6὎t\FSB]Bm "O;7 ;t$nd귇z 1܈)Y o˼l(UYT6&Ra (褪)8Ӵdl!`?w>8>eL^_;k;:\> I.J:%ixB!eQ=M0JNGEp\m,g*oUDTQVZjߘiW֊rE/{lad)! +/aVWRE*WKr9+r,i4Pd ꚽ"x—ו労lIn M-UӸ^}e%/+$̻ +r{]ɮVJEZP۟W>`Z:;RQ/-kEGeK] %dɞn1 KvvOvbn8rpX&|9n tϐcJdTWlb9Ċz$ -haA5Kk*i2HJ&GfKm^)5wkJ_-mꊃ 4̦90sFTUs«Fes6q@a Xa5SUҘ (*zr%ir1C Kzn.Ii2 S )MG8\'"a!!㯰+ƟpXn|왌# en^&阒K88ʹQ]5lFe2*f7p@!Uٯӯ&5ŽTkVn(Zqz(r++RqUvbH>Y'I&+C-w~r~g^<{Є (yc8 0>N"`;&~#Ӻbr` ^j3Eu7zӟ%\`B"@i1r\2B[tFdg$6*pѨGV֝=4Z~d3 ]H IʾSM4ޖwXlΛ{|JkŪ⩽`6|MIhpˇ.xi {*̉X2ָOI%Kd7OXw1"|Ւp&_s\ rW/:}?/;=`2 omngW\7|~֢!ab$R %X\?L/ ֩WB?c"nb#})+m+C7lCi^30+i}|7Q+֠<5.CTi-sex1^{꯲?Q?qg$WoNh}e WVW7TfaLۮ;*t g:e_~]bHxa?1 (ϒ2 l%K0%9XAbl\8' *DHKfw祣?DOWZCG } mK| bHhek#y %@!ah3m)HܢYZ߄IKV.lf=)'I{[n6%%2+c8H拉, bN\ڎo>y<1iI.<ɐNc-IxvI Aqe ܶy<L/Mn4%MVQ3)<#?h{p۹SXƧx-I$>KYJK~I191Ɋ"+&؄'b ^.1p `6>.<; ?^B:^6Tnuh~ׄ'o_xڮzRw)-] /`0p}xIcك{d)~ V{7*l?%6*h`'CYEBf}12lSF"s#B7Gعz0C -›Kuqw̯-;P,h}I1SG <'+vFVK@Q76U**ʫ?ui}ef*kC+c]0EgeMgU/I `J $%2%Ħ虡n*$;4"]ᱳCq?oǥzPd"R|xWCEJc^Jʒو~y֐r\P7]yx|}+:|nʎ*yo;G>y)kj]?F\ʁxדcȨ [LJ<[QV̲\pŲuf~6J5ٖKT-oJ(U TJѬT%:iEʫ],JBZ58Z6 bD+R%͂^2mVXCNsrc=BXHʘrFE|`MlcaGhNQ\ৃCOXx1,Dx$$ݤQbRte@C<Hf%|Kxy%H bb 81>l*8]d)Ŧ@yڃ|>bQH=x˃| w!^'J .'~f~>잿@3]ϭIz~;aq)T?LMf].nSxo~_Q~7C>O|vẝcM{Ƈܼ0{<_[Ħ}G;Z ]$ȴh5▟d^CInC* Ay:'rw}QAC\.%u4֭=n N^ܺ':ﺓ c^9<{<!tJYF7!DY$S_?sj Ųq\n%&xZzя==wt#Y3K7Z"XL:C >KqDǶ\??~&\5 yٶp{8AK ".pv YU(Sg3i}xσ *h%*a X_rHmGzV,LQʩ,ΨFE6ʂYZM/UtbUݴ%ڴ6_%*]c^VT, +LT8:) E $L"Z*ď>ɒ9MTKoJ/VhkTxC!Rj~B7B~!2372J5+5TLs^`VP_܎FҲ!M$G0FX]נ\+Ui&mZw}@-"iUZQPlfkk}B=FmSvߓ -1E{[p{n wRGչi@YH bnGK*uy+T|IbR *b (BH%(Z!H!!!h͢٧}$ v>J{W҇zު{I mwݐ-J:ϧBSȆL۴{^ %{%H2dk|3#ɀ yϺh[3C= t{F? 'uQ<=1z5Y!`y/unT>4]mA$RP;Z>pmbhnO ]&1󷢓 >qLaiǤ%:.!>?Ca5Qq 1᠛C̤J[&t7$MPtksC},]f317wd6ҵpfH\JA)bm pTJR ts@lZ6Le2|#Vf{CDx81L%euEHHM5I%&/EU5ҐDòs/ߢ ;qg; ~G֧B/s*_~*\U˙VjʞӠt C'=ßtP0n=h89z-b ɃWAv[塓L__*|)W~v/ݰqܩ}'0q+tINL'‡=G;h_~#74͞_95 ҭ u:@ {X}(3yĭ_n0>fz_QsT.$=Q4֛nyW rD&5FR属Υ꽷}tnn<1ah*x>c[_D:iHFL`gS@imG6^ҸG7WӧKxGNrRsQ[_3Bmed~֒5ueI:I*r %dilP,2qY ҙw@wlCc[4e.: d-ހ,]هmrlοD~d#=z!ٲ?8vJvRaIk\xty~>k?9>3hM=OdGtoI/`Fa&_BGô!2Ca9bCVLKW ALB26ь b>.YIxɵDE|#D"`eX`!hNx T9a !AE4*~qG%$K"/;5"eOYך!ho ,݂_ks(qMh|Mk)@E!aNxX+MeMpK^9F&~=e'~2z6̾ 0!z}&Ƃr|_xP.}ٵX~Z!nrA3fxP̝\TŘ&BaO7+V$:I2 Gzܷ`>7\~~~Z$Q G )D\o¦F4fL4 Dtؒ "=zq1$TQǨk& yX˔NF<T8V4ɈH|BFsӐ+،@xyZs.cJ9^ϺT(A/fl2hR&޴i4#$aL$  TOmW{-R%uTnb됲r>a`tRgql䉲-lH9*kVݗ-].T/5V,:}m Kʆ/S^=M(w:8@,ⷄh:OikiHIs?:ɑ"!eL׳S~Tv90iSq#s]/ %ZU^bx -L!3buˍ{9ZTLlWlpiv+&41-nrnv&BBuVyWF"azlv_#"bW+V{5>UtDr'nrByM|4Q?z0MòjyD/!yu];ܫZjJs߹ؘsN!sK,#r2o)3 ZxVԬxŀDcj@ QF.v`d{gg{zgЯ/VSoUST?e`O%QJgXwoM>}y96#nI/P![ZA`#s*G>!$HBC7)'%-&80<,ZTB-KHs]XX Lm+oBQٗ~׭_ ֗NT(NӀ"z1 BV4>+̓wQPmu7Eʠ >:Bvſ {~qߤadG ~~1Xyz/kt]_6!?Wy⯣_5 ׹eDi|х}2Ow8<S Ggp/v =>8yyLW/H: 21.F)ƝXW3sN~Ǯ?vk,0ɣ3!u3kIKы{ǎl21/E-1+Kw~׭{ #ekƸX2OAsZAHt2Hok4VqdQΘTń6_\6%mC6@ d[︲:K|WhަaTHENL5^_woˎkN ~98ֶi HDu>OHF_?4xBGuh>0 Ԇ.ܴ#?E~bgYht̜rƘGH!J I_B#q{ ,H ˋ#] g/´JG,!즈L+g5"2zZUhYԢe6FZJ#,bi4͡&/Ȇ7y}[|VII O \)(dKl* Z!;9 M 7O@jQ~ommRԈE9HRPK|~˗x\Iԕĕ=joV 狥LHwcZN,Oزq.Ɋ$k`hd^ ?<q<@-1a ksTKydpyEMy\hj)Лm b#0[{)r:s-x>fs9>u jyT?6syq7>}v=N1Wl ߰l{.H:!__My9SuhSX,.Ve\UQZd7 $%v{orsoHen̫{~/|3N|\j>l9zŖk?Q,/U잹rdنf(qvEeIҒXY7g19Ć4h_w.>!7%QņQ̳l\"ɑočg4Ն}qdwA1;q~0% ?$@` .e%1VlCNډZM%b N_!+J<"䊝^<Ȓ>G 6o+i*PՊ@eRd:E\\f"$eNJ+,<%(R fyqD(Q_FӼѓqivZN Z锍fSFk1=GmiY/s9oABL+#7kF9MtkOezO~g;Z۔sh{m/z%U{,H1vR8|:|dnC;A HiT[TV1cKGo>\dzTN;Rm9]2Pk7SX'zXe{YaNP%f$*OَMHQ(艹guT&dKKjqr-Y$c3l}uA Zsr4'-U 6_U >K(wW*KGIDgNHdũl_vӲS?FoEb^BLs+Nz4a^=lm ?x}#4%L-в|)<#kCjDаp\o\9١D)\b~jz=KDKovUX4K|Ą“H)L\,IZ(I6&p,%UUU|y}oM Z)?X.ēaP0JD̳jA Zeg ˃rAfȴC.E,he7ii&3!E@rnSH]Ӕ?1Qnpƫ4$%􆸖sΡP+Lf$4+9!olXlVB2OѺDj,ԍ1k\q+ntt&3VvsK/5czT֋JsQ.S 9a='7z_S59m)τT.&_A7]cZwvwnpZ5EϤu]꒮IZ7og2rF3Y9'#{>Ioms/"rvaѧ߃'(ʏ3X3ve򙩗'#5ixq1Y a꿂nsw vOӓb[Pt߂n?>:vf yuՇb 1L+.n:Zb|o1tZ :4}m?>99U}ѥP&}ģ&nX)Z)y嶽S^ 68 @1eϕaG+r4`Aӏ,BمA$SEa\ y`d4?ꁕQ ZY /W!Db&pHґ, 9CldFݤg Ce о:pUDbuB>yELY G"N]ET4PyJi #.&Ee LI xKЂ@ ^4BVYӫ۩Լ2y>rߪbP7]/GE{d#iYScAҡ 柏?} L зgw:kn!y$$T) Na f5x ^eYƖ,khmtK}jZX?40oUש[VsgƁ&].\[* mGt ^ɽ#S:u'ݐ6zyz}[wӿu¾DBm{lnꯞ>^i1U:cF 2f[7ܱS3GZE`93.u3:;D:!YyΘfƫ~Y)QE-rRVQdEdEG`wӉUrSudi?GՃ% MԎ9[0dutMAGy'DF!WKZ.A5 Vy=m\SxLE5O<]}UW=h8wu.P^ 1 ^tϞ]GZL1B.uTKxS?N50qC ,BUp8ا–)r4e+IC `&mdw Y( av]Hnj/QP@C, F38젨HB" [!` 4KH8"67 +ÈeG7h.cȓ$Вzg11l%ӄS d,(DK\;#QwJcO+ߒJ6WNRc" _o74E8%Q=>I"潢/tr=ֳoݧw,92pqZwLqT-aY etL bo5jKki뾙:g̅Q;EM?#!ǿXh8k<0 dRFȍ= ,ݑ X%W\lqW3f=`IsS56mrL?홎dzg ׼hi Ђj;AB IP0@iꭄhzj,K=6K3>8ghG`eN̳8q}솞pl={'-gmV}.0A<ܕ3#KJ{sadC|f:[Ii/H5=3,>u2 #"ONJRB*%b:#SUSJsR ʋV2[JgsB“1$Ƀ"] Yڤ3q39ͽb"IB9_A;S`4h}8LC1 !MZʱ<=ţndY&qC#\Bf\*+ᚒVS kzMʀ/f ]cj᣹l ,'XbJFҪrT4⚾j%T*pE,"wć{tTW|*|I-pӺG1 Kג[jaI&d䭪LT!sEzAƚśbm*zxY+ X}wigo 7WFS0 `2p;R=2p#ٸ+伖<9mE$p=UĄNn n $d٨͉t\2tD#JuU"δ.[y$P aiXC,>`Cdl2=ڞ@H > \J#A&CBAk@h-f/t̚@Bgہ&diC]BwxC[AUTH/)5;FeU@7!<CEBfEJM'U2 $')KՍ$B"d9LT%D %(gB"rHzth]e)\Y-9S|ρ,S, P/=O\raS۾}|6hl82QU\L:ysP}“rlm鍶ޞvtSS͔VªYЈ\=hz꾳T{OAc^3Vͮ;ߌ⸹qi;,!Si97_"n}9zozﹰmvyeF/%V6vocϺ-j}hCױ@IGRXOWZXo}4E4|}u~y E2>ϢQL"gA77d:ǤsFd꺴}x/$ft1feMU(y t X]I?raͪ=;w\??%Drq3u3Xg\V}۝wS=瀦`oh:.Ďmm#s;ta<@dr|)ےLy:8˿+MLKRI)$ 5Ly%Sd.Y=TBk{cIs%"m%!j5RVԕU6N @Pri%hn**k jSS ]LuTs '| P)ecL|q{8l'<;J]<kI@㪩ClO|#潃z7_E[R`SO`Yc%|^P2hU]Ѳˉ'KeCRz 6acoAMN߃}hlPt~j :w F^s@#9@_G;kv/9Ӧ- FLٽ^!IYud+qWx:B-qDKϱxc-ssٯ&4"3U qX" 1f1,6ȫd$[fYZj[}_$y᳌Lzx!@."!/[R5ÍSYU`ð720"%pY1ιgp<XrPGm#c,0 O^ymu;a0YA5 ZG Jc^TЇvD' "H\x<:ݭQJIgn^x-yY F9\fcٰ [LcKXaR,"Wѵ 9\dPy`/D+jح"[ &ٖ-Ͻp>>q.bPQ" h~1qK/{ǫS7t~v9mW6S -K|kiy'Dd1 }A!}3ues#U6܀ЅAH=ʲɓU|6tbɏvSkp3H1Eive^li!)ѺlY#g(zri0>:Zwhaɾ3'*fx8-WAQӑCi7xY}0>`t=K/27"%-g<ƺK`ԉfz_k¿%IVsiai%S,OH./jX#?<%ZWV\Cz>5k[@Ki!]df4j&4qct!/M2k:$+iUK"$i5kd5"1 Ho oNOEH7 [ѮxuK[SPOx*h-n e,n . xq[٦At1L fFGu ѨdKnn9<, ^x V7y;OX"[[?&Ҭ(Oi=<2$t1_M뒢E^ P .[) J^T5QBaeGiCHPPk{z9H/ßUýPdm:>&+CpZ,CU5MҊ*AUtF)ͺȩ"!2Pd.k!_-hKۦs3$Wu>׺!KԂ!o]n'*&E^{q4Iij2K9TZ\$(&#?wNژma]_]Jq)Xwapg/拾=u ~:F^>lvhbڲpms*+O 6Xj֦M{P[ځ[ߘc X³^|el.CY:8N[:r\f3t>>G/8-5e\,F<"Ӱ$1m, ^HqgF2$}x ǩ`TQuQE΄GZ)Y%YܨA> p* 0G%Y.lwS֛Hh{bd$M'}S_ϛ/ PCl|Tv||,&,w~v܁@ͧvL dIB6Td~ gc;eWȓtqQU4A( +qM!,ױ  CIW8֛=7 EK BXp#XaMB\,چsY\O!< *S(XA%:A*ɫRYL}Wܣ0b9h d@uOy7 nΕ#my bQOk6-mm|ʤOB<"֢'AopLP꺝9Ck!-Ui?kYoBxcl-T>~x] ӃXX)1޾+nu-]0vs受EÄkIԋQ x?6Dì.'a:MTTTlYAK΋{\*~/T#{F[sN+:hJ~e wr5!KY&,YU YECtM NUyU7'0 O) *l;z; ϝf~K _@Bu[ NWs5ά"6KemΑȕC'#]g-G$樬p j41 v"'fƂ+7Jy24̎YH3K+6ޗ NėDZ;{#a 3`BERva&w08Ys$Oo&D'[7#]h=-sl = ^ja`)?h[<&! '3ї^&ȵ<`O~lɆ DLV9WWxMdVkvg, :95 Q42)VML('1=f 090pncLZ:k%n$mlI`jkxWyfKXoTIL,^W9c;vvUg-^Fߜ4쟾w]#[jJ_80q3u_qO5xzW.l@CR\>IOZiՔ>{zw鐳~z9 HWT'2ZU&vfLI"ûoEFubbvj}r " KXPV&UG]dBgBl<; hz$m?rDy#` ","[ "||(~eqdP TWz*B +;(Q9Bk6L@5Cq<_ߔ^O\z'c["ػ_FHUlcDz}+ݯ=#Wi"JĪt:p췯|4: a'?/1f*+ ϊɜq!k0i}CI#sIxbDk(f SciDx1żLhcL9`*MԴF@МPBL1$9H,_gu ӤHNt&cm&#'RN24؞BapC hPn4^h@JhEd,$mfΛ<82fH mҖB@ }+(ƘcLqllablٺ,#˖dIHz$Y#/=uy)}H_@ӿ𝝝|vIqdPPfKjh[_M=K Q(".-5]UWT89륕[@gs!e9X WZqKn+9IY#4+q\dWEl+hUXz ԭRJJeN/I,K.3i%%p/v }yv82u tzdBp01 lH_f|$2bA,2Q=}5@3b3߄Gρ/"WéZT8nB!v2Wnٽ8VJ|9 0Vo|2xc3\碳( E eAыYl}O";s3 4ăa-Zt Q` Π!OV-6 #t:Lj !@'1" "PIZSAqpD'\Lv,::uD ?ħg@n+1pwޛ>&8PDa#,̥tҎEL7X8Ysڑrވa6acEdm)bÒ.rU)}r("dłdʓ2b6 >;fG`*IAeD8䧳I1 YPnTūF'ϭy1X&qgњ嵚Φ}s"Kj) Ivu>=yñFP֫Tuf/|fkaWv|ǎ}:qC_2ְkBwaa9ȵR.f 64oy;6vYq3΁ſؾ`i05#R@]b ߏ4p䣁۟ۮ|zk送Idoj[Ə~2|iDVcc'/Wc(gxL.Mo{Zh}|B@>৻Z!@&] 42i>>`^J efL`^ 04>p yQRi13ni֩Iѳ#uE'{f؛jg'6㦦7^e>nhni9Pgtotbq鈿~y]k5B!a03-12ư[}4ƁCB;;;bD(Ef$IRheiSV`=q4Z(0JA䥸Xy\"L)bI)|=2)(q󸂺)*ęߺ:c{|F\D%.#}9|MBT3ߒѿHx͔rRg5―p!nqo ƧЅ JR"UbO߽¢dRzeju} B[(%Ȑ NrTWwrVQsP.2zZ%ʗ~Z^UҜ1:"VZ%ussNJZlf>;f+o1R^s/#Ի`dF4sR^lOZr"'|܁n&q%@픫Gá^%m-HPr̯((*Y.x>J-4G/%v [n%_GgúS[l;}n*poNá{-{ꀇ-G:Ȧf4AsDYr4xÜw4%hֿ<{ŹMI2ɡ pD}d*H9K8͖h36"yr-កcu &`7y41*dGЎaXIQh;F<9=[ͷ}ؓ: ,0H_WgbOwڊja[Eֶ EDj+VD!I6!rL&dL"?e=~oy|yϏXX:}!Ƅ#I:Jb8b!: q0Pc'xlZq}ߜbE"|VbV0癄d @c"b(Q;nDQ$b69obh|h"H{&x#\)G LgzG3g7l82;E:αd$k} Z_.reSx}^e/Ul;_(qy4qbU7xT?)=}_OqjJw2࿖E. .2ښ?}IVޣce}  Wh=/tõ=M$mʉd.V&Ya/T.5zldHa]ӱ[',`qPyR]9{gf*j*&nWqMdY< "BѼqpeo?@$Z9r2܌Fj3oe[xP0n=EQHe$YY4hivE@F4W v|xD|r{`2ţNڦVי^=,l[R#In>w}s㶦ϗq0,E k>aU5{byC<@mX@?$LϤXG`ZxCKp\JL is$Z_8YøHڑNyɺEa)L\-ĭ[+)XA@¤Q#Y<x]:gc+iA9D&OX*MBn!cT@nMªBA+&s%!ϣ"q9>)t+mPЎDp`F҉ 0ٝ_7wv[K;R-d!O3i*KNi{gsg#Dr+3d΋Tn]OSq#Ylm ?.:_t{C9Ṉb)/81YI(`iueRiFt-PBtJHSԓYV*72=Z: P!=G"n&ENbEՌj1ʼn"E M>>46?wos|5y]5>E';a؅,u~:[bNiGz/o>D{7EtS l00@dk6Bx|EvNE,(` "N:c#7ᾥD`UԪ)gc|Kx⊶h#5L; iJǐ"+Q]1/T6~Jۮ:Sll !s/)n~|vYr?Mme_.8IAvN/ꃗ_(ov_دɣd@<䕃ƖfP1́Qv6kcN6W~2guOw ;O?gO[̆xgecwe(jQM@~?o6^ɛ@5^}QSM4ۀ[=mi_GW)mw݆Dins5(@ I@ 1sx<<3> 줯W7R=I7>GRbA+IiurlO❗c h\F:c󎆳-.JjЭ%:&C hXmEj/Y9<@]벧+Nn>7$, G!8Y}uҺS<`"6 =6~嵿L}wdWt..Yq>jw hx_0Pu0JٚJkuKLgd͍=NT;6Y' \et~';2EЩOG:8 v'mu82VMۋ<- a/@=*ǃr[ҵT[Z}PHaiʤнĹG'9tb6Rt(?*ya(I䏾TZPu 022GWį:^ڞ돿xJE4̛JKHw~_2֗pxqnyOcO"(R"ʙDPB#Ʀ{|F~p\SkpsI, 9 /#j".:PLRq%e2 4QֿTZW{ii&>m&xzgV InQeuOt?0=vh\#> '﮽ 7,m|п<wH(ؚHzX|L$t?HuqQrd6!RټS9&2PO* dHLA%6_fHv?z\zS7ߖJꉪku(d tm)tA,,3e\A(sjDt#DԞT,vq%Sڣs/GLFȦStBu@d,%0)^BxX\zx c22ٯ&34$iZP&- $0 4%vb1f`0 mmY%[K-KdIdIjv%nJm_(3<̜93P (Z4]LiiirG/zY0-̥n %ao=sV= {UC %l5<Yu2v `9s<^al^nQ ^8#]mC8Le~ .@?mGΦ4`h+0 S( K<#Ry״ma$hHb10:X&S<5fHl4? tC=mٶGG fx9} fZa$F

ӓo];5Ssx׎8nxYXCkW"7čMq{٣{ʤ:̬, wڮd)p騷1x#bHTk*r*9ؐkɘƒj_O/՟\,jf^T FEoCc3f8Z&o[j0KE8*`(BNƫ߬T~xr a"d^eY`՘͚~>nK:9֔l|<41O?'%XYyZTH|Xb4Iޖs4 20aB3^!ZaOE3$>ʔI=w;$v4ȯѧHh|觑i:?ͭ:Ƞ s> Y& 4NE=qb̺j_ 1E{uRoߋQ-ou‡o!*B XTd)L\n V]ՙ:^ds Z}O `e%8$P7cMr#fiҲ62H[WYӂ,9@dYBIFtu_#8uƞ=g ,’"DO(<-J(O?lBT@4&' g'iԨ-gL۲.hy@l 8qw/| HH%`lw'qϮFkBwk#MC0xRiG, sxww~7X2&q)m`Ő6Y(m&N>HS֪<_q>Hi@ 8+(<4c&y;\bhL.PQm\/?I3UWЌPtYSYO1SݥՎ4 t#8ڶ " cHa K=d!{f{} L*ss9ϯ싎c__7\O~a@sFm*!mƌd[ܧCn^:ee&jȫ[Tnu:,1hS:quDL⢺+Q麃CjRRΧץ,.3Κnuk?γ;V*2U5W\RY8a }(m]eJ'kmS?M8A\/fSs_|W^|љƮ&'$b+m7l;0%(jVF4+5O]mJѧh 1Qͳ i4jEZ(c9i9~HGYJ]p4}k}U_Uƣ!>`9$I󱘀0*aZ`d}gZ)ҷZ * _,A!‹NZ[LU0d-E*7GSvv1l|n֦xw!uZ5k{,O}-7 iqbXa) L!^|R:f3]\ŽiQLLx- d- ~ۡ*+H$DLM3G{" 5c#q'i@xgYZ TEQҲDAB&D$8V{3EP"&0Em%gZ9s̪#hÃ&rQFD8O:T^|I.AC|U}s xVD::_;£A09|B&$wEHFxBM8†/l G ^icQ,Z&5d̂EW/gbc`Ā"Nrs~ 4(0tYL?vQ ^ 6NuaHfn1']$mDGآ rE:8 K)xET_4!pJ:),JNgZi]ݍ)*ZmϫZTUM9G>lnJX gP+g+/ V=(~xhDenfV:דzRX͞%WsI2RSgPbBw{-VKaeMPup~E,mpٮZU|\f6 6s0^$8ˤB)Iw {|Z=\ˣU6҄lg A~:mZ}HzjdU׳q='xK0 vfaڸsgZi]]Q EDd1KƥA`KcNɕԭ#{WcMrcoY ƃ~aŀKON^IjFtOk{G7V3!pRFR`"a1qA4)T_?k/,Uڝ w+{r7{72 kpVo:9hx穌^IvOv뼷;٪bJVlYv[uBC!%J!lHI'q.$8q}OǞ3#>H`y';_,~hߏ}ᙺ, X_D/d*̥W U(Hx;4 yˋ{'>n>}r_SK(-*X'S#=@G3Gs"Ag-y~ ,[0?dmJB)za(|8-FDÊ؜KP3J{WCR,sIif04KG#z/he=%<iHUUrR\7o^>|sM@&K_OMbH8Wr#-L`dI\g $B:*ا0%]6nξl `XJb"ĥ"BByTQaFrEF-*(WREQ3Bjvidh t@ۑqEBbˀy鰕1CCa42e#6DE%նA{bN{BN4!k-FH*{ I'e4=g;[ӧH& `q1"lp E0Sa63{" H)LяΎǝ{ў.`~D10V0G@DABQt"^6EJq.G݉BTbt6VF!,t G>d(Rt.s}WM28]z/r.ILY/ ڈmCλ˨cp,)DĨ;H!/\Ltvsx%hI79{ B|.ʀ$F۵}nZb+ӄgeg8t&ӕOJMkB”G6v_ɋYԴ~|½HC)}Wީך^\<8vʼnzhi1c_<]|KTzU+5*v푹NSk?9-RF[#[&`CJj!deWqS/J YOsVbJ_emo:wXinZ8Dž_l ZE<P~j\LTktճ}i] dc;}Y?KEkq:@ xq i:H1cj\ uޢoe  K")>hWqp8A]è޹Ev0JMnxMT$!Xphb'u!h~6؍daο8sg.ZCǺ;XT PuZ\@6Q("aMB6=y׼ο2[;={y\yz-1X0K5kŷm,yRZd}."|^mfZd'FL*@1hm?$e1J0/[LΒzZX4Ϳ8(p:뛄z~<2SC6PiC k 'ȤO!2zN%NUU`8:F pg%b*qDBRc1">pqr{@Y"]苵_s76am:Br1/GR>4|t另;~& ɪYĬmTȀCQ$ГZ2(e- ILHtMA#sGW+! tՄőXKB`>q{+o ;dPL]4!׃uǭO;@Mkw|+Ӟox 7!n 66H8'\x.h9UfA:+e?{Zs*T#:Ƞ(٬%VahE~`;`#F,,`D[!IJ"mprPe^/0+I< ޯݽ\iˎeC{eX5$*qY ZJΓI9AB#@ytheDgWh1a%n&#ɛ̃PFr J"W"vhj$tYKj%앸2g^(! o㴺-мRΔѤ\/R>n/GD- <@91esAAi YuNQ+RKZ4.brLUHМ&S]~o~jII.Uhj60~41:ѱpGuҞ6ֈL7d~7zpzf:9u-lF$#"ôJ N*+`F5 )Pe9u+N˷@ E&`[Lo2iJ"O~8~2OYxНZpC^߄GtMY:>;q,"6]szǐa|FSsoZphR"$ Q+Sd<昂k4"x|*f,["@ ɤ1e} *"cw.zCe,!Ӡ?"1V@j}9,3yHPbE(oQm%P#Lslwkz0`=&<&ls/Vޭ#-/Rkdo:Y}hQ_|3Ss|/-KHvpss\dOVYma0V78_t/2MB0@Hb dHQxl|a˗lɷ%K$˺ϕV{JZ}H|`g%ݴ@2KW.h->o,,vه2NL2JS ǹK+r--W7&xa#eګ^+ Ia YHc_TXMd|i`4_~{7T2J\4i4eV>$ p/7JD%6!!& (L0f*@$f$>U35V_AdDLEaa&.&E6&bFY [:0Y8.fYHq!ӞY2aaa3c@ޤ& 7#ȿҏ68x<d1"+\y,S\P}8IĦkw"8sk'%w#Xx,GJSQ Y/VǥWlр xxu9(Q@j5a!Jj1*nӲHNf\UH6U!os%V+*K%H,DrT!} ʥ!q'xz0g3}TS)/>1o [[Jx!Xv4JWv$ !q nHKx$Aq: s4-pKR(@{B74̰]J(gʹmt#"/STT=$aEՙ"ْ= }g,`Jnmtw̻ė;2QL`t"*X4h\V R0_:h̦-c!?G2/Ӹ<Ҟx8^%1 R%?,VDQQB e0'8i6a9HZCOk 5j51Mg囝Nc]KXpH\b%  XJĬ,xJ$!6&.DEJt蠙|{ϧ ʹ ء/eW}s]1*Kly:ͦNjKNNX븰T~pȬ5UyjwɿnU\j9\ '00^؀/ ;<-k\M3u^%xɖ\4]x3wC;\@ݦ ^|Uz|RuSqCcBxim.@oЇݟ2d؉!S^2xjj?GcY}>PNRJ٧ݯZmּO<ا,fbp qowlD;d:kuރeDHl-q=?]#?rx{k68|a#{M@/<׶ځrz9> K|÷`H$" x)+r&%f0!"M00#AVYQwG/9+6*vvg'H4\1Vgj#oz4\q &@e-}}a5n3R*"yMXuH_ kX:%00w޻h] 5DQ3 %xNf(1~yܻ{֗^O`i82kA:}j<__iItt2CSv|6Ƙ#`d$$nvj/ᣙ?ҥڙ[3~^yY?e]"xΜ)mk Mh1+:4_r9g!"vY$K(`ɠ|y7j]S2c%V,6r+xB^XX-밂oJȊŜښxRs)۴`Y=[ dc"R.meŐtKyVIŘF92Ȧ1y;nUW [hξV*鸪K swOG'PL HHJP\69M:48*%Wˢ^QRI2i K%X:(jEՆ2WR KiG!>E@+>tLMoߎ6r [ lm٩k䶉9p^I1DN^3wSr'2-_,YHYk7Ʋyt-g>lcr`DMr>|ћ 957=Om?'8 n':ڵerO#@^&4)=l}Bϥ(J2,L;C!Rb̤]P4@+I}anr3S*0%!9R#g4w'tãw-\ܮ1pspO[4$yJUĢbtJc*dsbt"S?t->u;Zj=,^WzM?Ŀiݬ1{PZg^t4:oqc-]q&_U*bWx';p[ 7?_ztĦbU˗&Nzyt1; ֗GO_?(R꾂: sa1#Cq6rB/@օ7WѠ6v w}ʂr_Z:>mmX:{~kk\2ZMζ_k:b=oM.BUp$e TP/'t5]}ա_={t95/|_Nt=)[+~'2wAG0-@g|N;1P88󡾯.S_6U. Z˺Q-I^*m96X[]DWؕXߥ``*nlZ $$& eΝxqiP1}&0حet#qv`3}/];i9H5O(kKąϽ]+Θ*P,@giH$`,u3aOۻÏLa;ώEhxvU  HY"0þ~v{weev˻'7qbc,q I"NrJT{TkBI%& "8M'pi~[97_priK>3GћK^uF[[v^$$ߠV˨l]o煈%̄X 15Q ʂ+xx6"WjҬa٫6}Wo+.)3ϼ60$@"kFKŚRXҤRYu`shE7q*Z-he!5Q/ ˢuNyZIK|n  vΥ|Ҟ+"% {@}d\kIy)yt 2-hԮ-n -&ZR;4Z;@L)ДLS VghTb2r@ )%UE9rbluDحY,]YrUgar( r("•p $!!tw:ݝ! ʶۭy7;U~鮧~o=`u mKP5ֿ< j.^mt&zZ-z4lY\LHz6i}6R' hF.k"1f TƸSb'P\LɀX qXxK d$3qs⊾EYxRipåMѬtL3:l2(¤/==\UMtM=vw2HVl?>6-=6Pu^Qu\Z҂ KygA<q_).jUD"Ofngx\\v\6TFىCnGvKD7{_^_]rڵ:>A;a0blD9e//Z-)<>zן7]~baDRi(\#wW ~<2R~j&l6ES$@5 ޕܔ5>EOD֢[Ћ2<i):'v>ߚmC&bv8,nGcЋeDuZʍNMi0@$ jZ ŤiY6&MqL#tNE2}_Sn-mot*:UNA4Ó#.Kc$IFm/'&EFY:~!zj:ZܵbbRڹUI0hc5"`a(ӯlP xښ oΞ7(ut][WBc; Zmi: xfQ|51H:2ekð TJ"dVsL#nLȨkr`z=mq=4F/ ߊ0 $j )ne|0v:Sv*&(Dq8& YeCT~pMnRU0r>SҫD#Mx}0{ HviuO M5vL4,X03OϒGs$ǥ7 N f䇙B>0h.|OOlh#Q3 YAWg]/;'aCg xj@U#Gţ쎪#o@P$a 1, ٔ}Y)yu䬩Js2 "~E 0bB1X"Qo< `W#c ~*4+}=ut?\_1Jw~/;}oӕ t+xՌG q[fܧP12AwbGeܫ^ݩWC+J:\&#Q:Xvf8T-ETNFC7^ xJQ|2ņ}6q(X^Al2pC_tuioz;|V n:cS~isYSo}h[X8Q̟"P:IЩ8"bT f̯G[>tH nk{Rn,Ko_{#[

s[g}zP )_j4,-0>B+ѲBEّIݘ#KnElS<`>$O;&v`OZYl%yB>)lPtb\͵+7=Զn7uT+L̋fԦqimuzmQZpe\ BdGBBB$$7r%e.|wUz^=}s=wow=థQ|PY+^hEQL]ܥ/h]Z|+@cO[Q5ٷɖ?j'}_B.}"gyhkL(rDkAd4jF2s aⶢSⷔPLedCc.j}np~x3Xą0hJƩT-' &QkhWɜkєjɚK+oSUL7"&3cMU:=9c9վk6] h3@$)DO膣4ʒoq;T\1u^߳u׸u{|#vDl[I@CRar !5?pT8y6Oi1XLrNC* Me 3T"^㬓b", X_FҍɌCHd$akDU?{@dEY~QL#e:/s,n%:ĭ}\PM znu[]gWxPd j<P-1,[LG(z̠D,esto%Zo&<P|iZm~.>fթZ$Sܲgi,MfEZܢ5=(HBIv5N$-ٛF&lD=\#d? b~Y28ʊC '=ϾuwqK=N?/ o']/ESŹ6Sw!x>%R7}HZ v1ti7U#ҹ{^w ?QͿkZ-g 'v G_N>>|t@Y{X%;+.j.oVf~fk UMN; ;ք_7V(n>f0暣AlP@;{Z4 ,vc/u7Ύ=OO+=GuUGƓ0UnW=V_8"/h캌Ey4RNrYG}QJ/_h%RdiEZýվ~014u?X4cQUꮈ|` '92;1?Xcag dռb[s,/2V8bVyJ$HC__0\HK= 8KB&cQo`~R{Wl%ԔxpBVb6GT̂}h^niev+Z+ta85w.Y~ďqڡs8\ٔDSm,8*RH" ;'G^j1u4&̘f۟f$i`f,0ҴFQKt CfQ!td: -P#3k`ˆM@#ܤ2"p/3 ΐ-Bؙ ~INaZ;fpE1~ hWrV {4Zfе I׫Ꚉ:j"KGL?>3ݭ#NifڍUDdQYY!dٷJRI*U*IU$,Osmfx߹TUwa(cc!t%3I˾?:,ɟTG00J^6h~r5ё]uߤو)rlFHfsxy0 `<:78?&r ^I4mHc[>8"7J@W;%V]gTfv_Uy.@PE U$'{>-n;xޥ^t'mL'EC*K#0N'ʭut٬ھBBmiUYٽBm/_I*w |MyDCEjig8]7v6PPS"LaCȠ ϩD[?s-OTt-My3dξaIk+ع ǕrQahy< Ynm쫦2}grY`yX#(+&Oy0ŵJp H7gLޯ4[_Q~ aїǞ՜75$tJZ7ל 7՟^>4`t8#S(qUXELm|}ƕJt@ qt{&-`ɴXkWa0<;:5aᱝZ|뤨h]N?Nz˔IBa֢;K>P(+9h|tKX]}n,cZi8+zRu3\|Ym[on:CX,L64[;Mڡ2kZeC$Iv=:m5!ԇ9 }4u2"]A@0+R#/n^8=UszbJ0a`vCـc>m^IF|FaeV_tFiH6RMyA Hbm4Rјd\4n#Y?!,H?VGe"3@ЇodDv{k{Ϋ KʦkVO˾yRl/g )PKB~ (ؙ/e61{۷o ,½e38(*e{p%m w/;' ƄWP $H@k~ΙN4Xgb, 0Vp|BNlI~e 7& 2|X^{H!@Рׁ@9eCr`xY5j_Wk WBӺ0z!9:Uϭ`-͘yuv>kE}jpaR VgBa= ȯKg@gsv]ẀyO${iNY&ڳK۠4rtF`Ga[q=1Q{(1kq;;H ɡCmQEN\뙡NMQ]92| iZm!:J$tj"}`k ^RA=RTn#g0OH%ȯ%?>}Ŵn(FO>F[:LP4QBh]co#4cX$yT>mDlD>jKЬ yŌ3>\i}vMqK?oX%eٱ,2ϕSZY\gS{dӐݡlye~pmobhp[N_Oz `9&ӳe22*[.7&5d/.Tg]̕Nۯ5UZC7=LF?Y,jfo1?8ӎR+q~+&̻dKuX dr1Xw٠C z0c֭ 4#TET;臌P0ӷ12'(y\#q8u|EP _߇}h<\|d ^*dE@.*@f$ th׼;sC#^kح a^G=UrVV1mԽyaT&:>(Yrn[kXuMHY7ZMhZ$鎆 E?RBX''Zly_7FeISHە8OZj<ϘS~yO|$s4N@ԃL~ "9"=w C=i{?.l09}Wy;. )O\bFKMbU!Qo\Q.I*tMpg/,zac0Dd+]7V:o2Kp2bO}Bi4 &D,i(  w)VwK+M[E+vc@Nc9%0PZeYV._cEŚF "۽ ǜAи"NQysp PtˊC;&R[W(o4 \\88&VTUm5q7fvjfjJv*uB CoD18 g8L$ꄤӹI';ݝ>r/َ)|^_UU?O;=- ;tW׫N^?\q|܂Nr*QxIGWqypU]vl+75MlFoO7^n +Aik V,/uUiuHe(* Ğfʍ&Ii!Ǽ<{Ѹ׽sVs~x Ou^QMx%5$s- _SPPEFt]4S!2?dYDits1 qY KA4A4\:cdLn%4a{VsaZkM0Vo )W :*j C0 6$\<{e<;(Vī"t|}dJoIi̤)x.|i=4$ fft*F'OPEI&lc$3|M\ggf,յ[kT%{bWwzw#M6E[ڌ8d>xK,Vbh7bI$=w޽vc]ht[>?w1PfU)>"J a.q"HAj5nLT:N^,>d`]t7HpG'A`sU/(k1i.`` &?ӚH .$K|'dEooY6#laRi&S]da7D 󯼲;njWE/a[T30Σ#^U4l#R(j0LBZl}6(!FԿRov͢ǐX0o6]+nщͺ//UuO,'B Luo'?I'4%҅DK[ֱo[jLwO,6^q/;][0 aE<0a7k->ٵ:4{/w|Qoޔi\Ga&/f͙g%<>ެZ}LJ l@lwɃWe-L9,cM9@"̠fn!a@ W}ӺkFMT$_yԱ6Y4TT\~500|M#j4zag9&|q IP p3ȿX"a3u㘟@?>i]{BP:2 l |4ӏԙ+t{#5}AeB'䓇Y6w/r. \e3tn_KGn<ΓT +"c!oP8<4A&Oe>_Z+˜e06c9a(.;'Qlc\b70("W"H;~ѬoQݽ}1yw< .CkrNЏ.t#zh7ڽ=,M-W@aS#oKæAO*:_OMiufqquP%\ ,r 9fS $@NtN#`d׭Z*>]U]W8 9MQ=qH`|Xis0J Նfg5f^żZ8 &"5f_ԶWTvhڻeUKY0X*[鵏jN`quWZy~:,0L-k p[8 XUe 1%dڭ`Й qЅUܙsY$I(v|NiXq0JQ9"(SDl Q2bZ3(BJ FquzBu'Te IrFl& 3]yXN;hۜ ^Zq(sg`@(cPG0@x X{fRN{tfƳܦ/OE$r|.#io7]EZ9Y7I{NM Fh΋i!c.d}āW>+h-d+wx;D%ŢJjB!F0Z@F~UI%RGfHA;P$)|ݦ[9ͽweD̹!>"Ig*eȁm9.itB ̗$^?~ +kiSXpmwvqU{2"\Mj;M :IDg<㔟Qj'%qGSD"JR݆87jV:AE4[ZӵFtN՚72hWwel ժ9k/w^l_#J :cA!4LR_xPvaȝń3޹rC[rf*?_i1Z΋~-c Mw=. q&d6Y/}uͪ\YX-;wӯD8eڹg&=7݉QPDA4n#n`<"H0N8<1p!i ZGK&nYZUZ~S)(ƭM l6J>bmԽ>\&I*6Wpk(^'l_AfQ]0vYi;:ëFݱ.>$|.~<<чaܛ~n,o3 0gX]S>frLz;N"SFT,N-`;MQ5 D'H8 JvM|Mhj S5xX.6o~18 K YA\n5;>ٴ{fuA+iYiA[{ԣKXJ`c8 YtoGzIl8u)Ŝ{nSPԈpW}rAuYwMW[ztV^_yGaVo/ŠoYe{εF;9_i|Fjfuh_<2,3Z[}bƜO :>񼜷ΐc }7f D bu5 rHe0Ĉ F'ES>Fjp‚Qƭ$R$,bdq\8b=5Y_:0 1]I7ic^{ܪF(vt!OoPm2O =zh2JzP~{fg[I_БQVꢠD]S\dܥ5b(Z7TQ]};}`"`͹s{ B汃#.+ i_+O-6rJEW~*? d<dE٭=? Hd܉]UZ~zS=/m)XeɎbX?- d^U[lV32 0;(EV #*-s'\H:I7I::K(d|sN:Vsާ,*5ћI s׮ kJ @ʖč)yZ:%gW/ j5{.Ȧ}9*ǚ {dV3i<=iu>-7]T0i di`0aw4,Ib35yKq-gt龂`i}a`W)z|q'A*t%ǟ-:~l9T6X|p%4l7dEBm$"4M A3>-$-k,WۖG˚s՝Ee5j볲UQխE|X,^,MCD!°ס C:$b ? (qiGjF+~>9 0ο w?+Cl[bktSPe+Q?NUؘ=|_gw|;{Һ@`!}-:^J/,W fEkSt.Eu+{wɵ\p6Z{(( WS~tC%Lv"a U%&D:H٤I2BgEhsз`}鸫'QBCW5w}j%#`j?-\.0vňߣOG|::xtaF>׃+?iq;fX~ꓓ'1;ݯS8eoϐ &K4~:7ũ FgΤ()"QϢ"¯(.Yzuՠïjɷ7h `f׏9n@x=T}a fc"Ö^eoҶ6\1jJ^x_iK{0%[Α6(E,!R, h4el%͸M1N ew*w7o]eλ?;y7b^zG7ً3GˀҌ8UmOlѕ1$_$!Ո#62pT>t$QG6B~P&lBLc@EPt:Mf2t&.tNgO.vv$dlRt6 LgdNA[ؽ`#@&eC>bg'1pa ζt&h c^-q6JW5P[EH:v,#K\R}zɣQwoFM['wL]Uc}?K뺚ǙThrB9Qùx瞹_J@ŀ 7rknyEI5F؂ 2E2nm>d {[̽KrJ^ig;yM갍l qe*ǧ lN` lh6jF@nQn2:bsPTD_G=:a3 VFySilm2;;ŬxP3 (* " "" ^HPK@ѹ;w:ttwBH2dXo*zy~oDTWN{t[kx Iq6`F<{16Y-_k9ڰ;8&V*ࢎOv:A2wE,8^OQkj|̧TjJ+~Svx^_^nV- *7;_5)AI*F^X$w5M]x!~yl^x۲TcݸZa߀v 0ކlMw=֥OObXV3\kd+ آND=1J63zHxJ2`KoKS_h]IWwv5H,zbN褁gv>kmj7$hsƘo^ϩӍ5v@oXBAsS~mT5et[-ך~ @놛7vD_McgN\ 'DO^Zڊ\`iE$e'Wh,7^;6SWn:!w0;R^'W4K/oXVURG;drV7es:7'D7I*NS~VaePN2k㢲ce-XthcizqQ2p{FY.n*_@^>w}bc}%%Xʛ̌d1#ro??Ku婚;Ӱ48,8fJ}I]%2Ӣ_o\a Xb `K.Y$i*Lh5(JIѨ[FuZCڀöD6a׳nHȉ뤡&CUL ,H 1.*Z(&P aJc)6"vc҆#߂{D :Zͷ*o\鹤k>Pn02`}lwN9[5bPqU|;ze^5ev㨋EH2}R<\;n짿lU5߿1{~|Q?'uJmOmת9O{\> _:CzX"!M8ňv:6,]ڮ;^[_ZW)kbB=񸝢, Iv{}ƶϪoxJ}BfװG@~I|Jfwgf-0{DR-f>GB!o͕8^Q>Mry:>wpT#.: K"dHv{cBZN~( ֞b(NʅַWw Ou(^i28Og夽X SW ;N˪:J|ጬቺIMC啬G4XO?Kj {*VO,Wp m>󬐏h(_,Ri:7R)Pk-!#H:@ġG:N-l.ӖKurqIfrlr[& jVg&J.JuoȌnQ 9pVv/0r?} wt-ծۈ=d_d=1+\arfyڻh "p!Ñ4iXd~eJ1